1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serga [27]
3 years ago
10

A 1 M solution of glucose is 180 g of glucose in a 1 liter solution. If you wanted to make a solution of 0.2 M glucose, how many

grams of glucose would you need?
Biology
1 answer:
Shkiper50 [21]3 years ago
6 0

Answer:

36 g

Explanation:

Data provided in the question:

A 1 M solution of glucose = 180 g of glucose in a 1 liter solution

i.e Mass of solute = 180 g

Now,

Molarity = [ Number of moles of solute ] ÷ [ Volume Solution in liters ]

also,

Number of moles of solute = \frac{\text{Mass of solute}}{\text{Molar Mass of solute}}

Thus,

1 M = \frac{\frac{180\ g}{\text{Molar mass}}}{1\ \L}

or

Molar mass = 180 g

Therefore,

For molarity = 0.2 M

we have for per liter of solution

0.2 M = \frac{\frac{\text{Mass of glucose}}{180}}{1\ \L}

or

Molar glucose = 0.2 × 180

= 36 g

You might be interested in
What is the creative development of science to solove problems or to make tasks easier called
zubka84 [21]

Answer:

i think its a computer because copmuter is a multiy task machine that can solve our many problem

Explanation:

there alot of discoveries of science thst can solve our problem

7 0
3 years ago
Phenotypic features that are coded for by several genes, such as eye color in humans, are called
alukav5142 [94]
They are called polygenic 
4 0
2 years ago
Water molecules form into water droplets by clinging to dust or other small particles suspended in the atmosphere, forming cloud
stepladder [879]
I think it would be transpiration
4 0
3 years ago
A student drew the model below to represent a part of a watershed and some human activities that afect the watershed how do the
Ivanshal [37]

Answer:The answer is B bro

Explanation:

3 0
3 years ago
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
Other questions:
  • A review of the cladogram shows a common ancestor for these four types of vertebrates. Which statement BEST explains the genetic
    13·2 answers
  • In a cell that is undergoing mitosis, sister chromatids have aligned along the cell's equator, and spindle fibers have attached
    5·2 answers
  • Mad cow disease is an infectious disease where one misfolded protein causes all other copies of the protein to begin misfolding.
    7·1 answer
  • Cells are the basic structural and functional units of life. This statement is
    7·1 answer
  • HEEELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
    7·2 answers
  • 8. The process that occurs only in the small intestine to increase the absorption of
    13·1 answer
  • Describe two factors that are responsible for regulating the cell cycle. What is their role in the regulation process?
    7·1 answer
  • Please help!!<br>Need the correct answer<br>Urgent<br>Will give the brainliest​
    5·1 answer
  • vascular plants have efficient systems from transporting water and other nutrients. The______ transports water and minerals whil
    15·1 answer
  • Which one would you rather be?<br> A. wolf<br> B. shark<br> C. cat<br> D. fish<br> E. lizard
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!