Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
True
Explanation:
Unlike eukaryotic cells, which have a nucleus that contains the genome and is separated from the cytoplasm by a membrane, the prokaryotic nucleoid is not membrane-bound and is not considered an organelle. The nucleoid is simply the area within a prokaryiotic cell where its DNA is located.
Answer:
Patrick's hypothesis was "If fish eat microwaved food, then they will swim faster through the maze."
The fish that are in the control group are the fish without microwaved food.
The independent variable is the microwaved food.
The dependent variable was the time it took for the fish to swim through the maze.
Patrick's conclusion should be that the special food did not seem to make a large difference in helping the fish become faster, since 8 out of 10 fish were faster in both special food and regular food groups.
<span>Answer
1. electrical signal travels toward the heart
2. signal by the nodes in the atrium</span>
3. the atria contract<span>
</span>4. signal received by the atrioventricular node
5. signal transferred to the ventricles
6. the ventricles contract
Heart has a pacemaker that will continually send a signal. The primary site of the pacemaker is at the sinoatrial node, on the top right atrium. This node will send a signal to atria (which will cause it to contract) and to the atrioventricular node.
Atrioventricular node located between atrium and ventricle. It will send the signal to the ventricle(by the bundle of his) and cause it to contract.
