1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex17521 [72]
3 years ago
6

What are cofactors to enzymes

Biology
1 answer:
Vesna [10]3 years ago
5 0

Answer:

Some enzymes require the addition of another non-protein molecule to function as an enzyme. These are known as cofactors, and without these enzymes remain within the inactive.

Explanation:

^^

You might be interested in
Which part of the mantle is made off soft rock?
Juliette [100K]
Outer core is the answer because mantle dissolved at one time
3 0
4 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Angiosperms are thought to have originated in which period?.
Nuetrik [128]

Answer:

Angiosperms evolved during the late Cretaceous Period, about 125-100 million years ago.

hope it helps.

4 0
2 years ago
Part of the central nervous system​
Alinara [238K]

Answer:

spinal cord axoion spine all might be related to your question

4 0
3 years ago
A new microorganism has been isolated from hot springs in Yellowstone National Park. It consists of single cells, which appear t
ad-work [718]

Answer: B- Bacteria

Explanation: Bacteria are infinitesimal organisms that have single cells that grow in different atmospheres. They have an easily understood inside arrangement. Their cells are normally surrounded by two shielding coverings which are an external cell continuous vertical structure and a cell pliable sheet-like structure acting as a boundary inside. However, some bacteria do have a third shielding sheet furthest from the center named the capsule.

5 0
3 years ago
Read 2 more answers
Other questions:
  • A geologist finds an unidentified fossilized rock in a box in the attic. What type of dating would the scientist attempt to use
    11·2 answers
  • In general what is the purpose of a checkpoint in the cell cycle
    9·2 answers
  • Which process uses acetyl COA as a reactant?
    7·1 answer
  • The vocal cords are two bands of tissue that extend across the opening of the: larynx glottis trachea epiglottis
    5·1 answer
  • What is the solution?<br>-3=t-12​
    8·2 answers
  • I really need this done right now!!!!!
    13·2 answers
  • The owners of a local bakery ask for your help in improving a special yeast strain they use to make bread. They would like you t
    8·1 answer
  • Stores and transports materials in the cell?
    12·2 answers
  • In muscle cells, fermentation produces not alcohol but.
    8·1 answer
  • Identify two intervention strategies that have been put in place by the government to address lifestyle diseases.Explain a posit
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!