1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
5

3419059779 ppppppppppppppp1234​

Biology
2 answers:
Rus_ich [418]3 years ago
4 0

Answer:

hi

Explanation:

hi

elena-s [515]3 years ago
3 0

Answer:

dvdhhdvsjjsveoskdbhsjdhhwjdjhxhhshd

You might be interested in
The scientific name of the sugar maple is Acer saccharum. What does each part of the name designate?
irinina [24]

Answer:Acer represents the genus name while

saccharum represents the species.

Explanation:

In a way to classify organisms, biologists used certain important common features to structure them into groups. The arrangement of living organisms in this hierarchy from the highest level to the lowest is as follows:

Kingdom--> phylum-->class-->order--> Family-->genus--> species.

The largest group of organisms is kingdom while species is the smallest unit of classification.

The common name of the plant used in the question above is sugar maple. Biologist, however, use a standard system to name living organisms. Each kind of organism is given two names, hence the term BINOMIAL NOMENCLATURE.

--> The first name is the name of the genus to which the organism belongs.

--> The second name is the name of the species to which it belongs.

Both names are printed in italics with only the genus name having an initial capital letter. Hence, the scientific name of sugar maple is Acer saccharum( in italics).

8 0
3 years ago
Can green plants and humans us the same process to create atp
alexandr402 [8]

Answer:

yes they can

Explanation:

they go through the same chemical process/breakdown of food to create energy

5 0
2 years ago
Read 2 more answers
A random change in the sequence of DNA is called a
lorasvet [3.4K]

Answer:

mutation

Explanation:

A mutation is a random change to genetic material. ... If a mutation occurs in a gene that results in a change to the sequence of DNA bases, then the structure of the protein that is made may also be altered. This could alter an individual's phenotype

6 0
4 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What is the human embryo called after the eighth week of development?
12345 [234]

Answer:

fter 8 weeks of pregnancy it's called the fetus

8 0
3 years ago
Read 2 more answers
Other questions:
  • The organism displays a yellow and black banding pattern that is referred to as cryptic coloration. The banding pattern serves a
    15·1 answer
  • The client who experiences residual arm pain after a fall has been referred to an acupuncture treatment center. what is the nurs
    11·1 answer
  • Why are flash floods more common in dry climates than wet climates?
    7·1 answer
  • Which observation tool is the most advanced?
    14·2 answers
  • Which equation best represents the process of photosynthesis ?
    5·1 answer
  • You might find _____ in the Arctic.
    13·2 answers
  • The genotype of individual 2 could be
    6·1 answer
  • How multicellular organisms reproduce? plz help ​
    12·1 answer
  • A human cell with 46 chromosomes undergoes meiosis. What will be the product at the end of meiosis?
    13·1 answer
  • What are the 5 stages of mitosis and what happens in each stage?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!