1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksju [112]
3 years ago
6

Can anyone help p,ease

Biology
2 answers:
antoniya [11.8K]3 years ago
3 0

Answer:

im not understanding :(

Explanation:

IgorLugansk [536]3 years ago
3 0
You need to add the chart to the question
You might be interested in
Why are multiple forms of documentation used at the scene of a mysterious death (note taking, sketching, photography, or videogr
neonofarm [45]

Answer: They help reconstruct what happened the most precisely

3 0
3 years ago
Not multiple choice.The function of the larger, more typical pinecone is:
ddd [48]
To produce eggs.

The large pinecones we typically see are female cones which house the eggs and then becomes a seed. The little cones that we don’t really notice are male cones
3 0
3 years ago
Read 2 more answers
What type of property cannot be seen just by observing with senses
klemol [59]
The atom? gas? either one of those two would work
7 0
3 years ago
What is responsible for transport of amino acids to the ribosome during protein synthesis?
UkoKoshka [18]
Messenger RNA (mRNA) molecules carry the coding sequences for protein synthesis and are called transcripts; ribosomal RNA (rRNA) molecules form the core of a cell's ribosomes (the structures in which protein synthesis takes place); and transfer RNA<span> (tRNA) molecules carry amino acids to the ribosomes during protein synthesis.</span>
4 0
4 years ago
What is the dietary iron of food sources not associated with hemoglobin called?
photoshop1234 [79]
Hello!

I believe the correct answer would be: Nonheme Iron.

I really hope my answer helped you! :)
7 0
4 years ago
Other questions:
  • 3. Which type of neuron carries messages within the central nervous system?
    5·1 answer
  • Describe a structural adaptation that wolves have for getting energy.
    5·1 answer
  • A nurse reminds a client that it is time for group therapy. the client responds by shouting, "you're always telling me what to d
    8·1 answer
  • What are bananas made of
    13·1 answer
  • The steps in the scientific method are typically shown in a circular process. why
    10·1 answer
  • Are ecosystem services considered natural capital?
    8·1 answer
  • Shortly after adopting his cat, Sassy, Thomas realizes that his poor cat isn’t eating very much. After ruling out any illnesses,
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Muddy water contains microorganisms, clay, and silt. Which of the following statements suggests that muddy water is a suspension
    6·1 answer
  • Genetic mutation which can lead to diversity between organisms can be caused by
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!