1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ostrovityanka [42]
3 years ago
6

Why do some people live near volcanoes or in flood plains?

Biology
1 answer:
joja [24]3 years ago
6 0

Answer:

Today, many millions of people live close to volcanoes for this very reason. People live close to volcanoes because Geothermal energy can be harnessed by using the steam from underground which has been heated by the Earth's magma. ... Apart from the volcano itself, hot springs and geysers can also bring in the tourists.

You might be interested in
The Calvin cycle is another name for the
Yuliya22 [10]
A. light-independent reactions.
3 0
4 years ago
Which statement is one component of the cell theory?
Wittaler [7]

The options attached to the question above are given below:

A. All living and nonliving things consist of one or more cells.

B. Cells and living organisms are spontaneously created.

C. Cells are the most complex unit of structure and function in living things.

D. A cell is the basic unit of structure and function of all organisms

ANSWER

The correct option is D.

The cell theory is one of the major theories in biology and it states the facts about living cells. The theory states that, the cell is the most basic unit of all organisms and all living organisms are made up of one or more cells. The organisms that are made up of only one cell are described as unicellular while those that possess many cells are described as multi cellular. The theory also states that all cells come from pre-existing cells.



7 0
3 years ago
Read 2 more answers
Where is magnet the strongest
lions [1.4K]
The magnetic field of a bar magnet is the strongest at either pole of the magnet. It is equally strong at the North Pole when compared with the south pole. So I would say the answer is A.
8 0
3 years ago
What traits can make a cell special, why are cells specialized…<br><br> (Minimum 5 sentences)
saw5 [17]

Answer:

They are modified by shape, function, or size. They are made to have certain roles in different parts of our bodies. These cells group together to make/form tissues. Then these tissues make up organs that we obviously need. Different specialized cells include blood cells, nerve cells, and reproductive cells.

Explanation:

3 0
2 years ago
10 POINTS
tatiyna

Answer:

The answer is C

Explanation:

8 0
3 years ago
Other questions:
  • Water-soluble and fat-soluble vitamins differ in which way
    12·1 answer
  • Please define these terms so Middle schoolers can understand: Groundwater discharge, streamflow, water storage in ice and snow,
    12·1 answer
  • Name and classify Hg, Ni, and Ti.
    12·2 answers
  • Analyze the need for laws to control water resources ,and compare water rights doctrine in the eastern U.S to that of the wester
    13·1 answer
  • Which two layers of Earth are mainly composed of metallic elements such as nickel and iron, which are abundant in meteoroids and
    5·2 answers
  • When resources are limited, explain 4 ways by which lizard species on the Bahamas Island can coexist
    5·1 answer
  • А<br> is an environment in which an organism's needs are met.
    8·2 answers
  • What are two new pieces of information you learned from the artide? Did the information in the article support of contradict you
    14·1 answer
  • As the number of prey increases the amount of predator decreases<br><br> TRUE or FALSE
    12·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!