Answer:
Scientist 1
Explanation:
<em>The conclusion of scientists 1 is valid.</em>
Human activities such as burning of fossil fuels, agriculture, deforestation, etc. leads to the emission of carbon in the form of carbon dioxide into the atmosphere. <em>An increase in the population of a city will only lead to an increase in these activities and hence, an increase in the amount of carbon emitted into the atmosphere.</em>
Also, volcanic activities leads to the production of volcanic gases which is a mixture of carbon dioxide, oxides of sulfur, nitrogen, etc.
<u>However, an active volcano that is several miles away from the city might not be a major source of carbon in the air above a large city. The carbon dioxide produced from such volcanic activity thins out before reaching the city.</u>
Answer:
The correct answer is "T" True.
Explanation:
Pakistan have traditional gender roles defined by a patriarchal society, where men are authority figures. and women have a limited participation in society. In Pakistan, girls are taught to obey her parents and other authority figures since a young age as they should follow a series of rule to fit in her traditional gender roles. The women's traditional role in Pakistan include being obedient, organized, compromised, maintain hospitality and take care of their children.
Answer:
<em>When a baby is born, the zygote has become about </em><em><u>26 </u></em><em>billion cells</em>
Explanation:
Cell: Cell is defined as the structural and functional unit of living thing. I.e The cell is the simplest and the basic unit of life. All living things are made of cell.
Zygote: A zygote is a single cell formed from the union of a male cell called sperm and a female cell called egg.
<em>When a baby is born, the zygote has become about </em><em><u>26 </u></em><em>billion cells</em>
<em></em>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:B.
It was used to prove that smoking causes health problems.
Explanation:
