1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Radda [10]
2 years ago
6

Identifying Cloud Types

Biology
2 answers:
dybincka [34]2 years ago
8 0

Answer:

\huge\red{\boxed{\mathfrak{Hello}}}

Huh? You have already given the answer.......Anyways, the attached picture is an example for a stratus cloud ☁️.

loris [4]2 years ago
4 0

Answer:

c :)

Explanation:

You might be interested in
Ileocecal sphincter tone decreases (relaxes) after distention of which structure?
stepan [7]
Ileocecal sphincter tone decreases after distention of colon. This sphincter separates ileum and cecum and is under the control of vagus nerve. 
6 0
3 years ago
Can someone please help find the definitions to my biology vocabulary!!
Ann [662]
Codominance - <span>A form of dominance in which the alleles of a gene pair in a heterozygote are fully expressed thereby resulting in offspring with a phenotype that is neither dominant nor recessive.

</span>Mutation<span> occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene.</span>
7 0
3 years ago
Part two of can you help me
riadik2000 [5.3K]

Explanation:

all are man made for exact answer

3 0
3 years ago
The brain chemical neuropeptide y is known to specifically enhance the craving for ____.​
timofeeve [1]
<span>neuropeptide is know to cause a craving for carbohydrates.</span>
5 0
3 years ago
True or False. All mutations result in a change to the amino acid.<br> O True<br> False
maw [93]

Answer:

False false false false false false false false false false false

7 0
2 years ago
Read 2 more answers
Other questions:
  • The three types of ocean floor sediments are classified according to their _____
    15·2 answers
  • Tina is conducting an investigation on bicycle helmet aerodynamics. She is trying to find out what kind of helmet causes the lea
    15·2 answers
  • Use this chart of a portion of a dichotomous key to answer the question. dichotomous key which question distinguishes organism x
    6·2 answers
  • Data must be considered valid for scientists to trust conclusions. Which is the best way to increase the validity of data in an
    12·2 answers
  • Emma has multiple sclerosis. If you could view her nervoussystem you would find
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Fill in the blanks to complete the passage.
    7·2 answers
  • The total magnification of a specimen viewed under a compound light microscope is determined by the power of the objective lens
    6·2 answers
  • What is a greenhouse system​
    15·2 answers
  • Vestigial structures-definition
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!