1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinil7 [7]
2 years ago
12

These aliens can be either green or purple. The dominant trait is green, and the

Biology
2 answers:
Natasha_Volkova [10]2 years ago
5 0

Answer:

The answer is Ccee (C is the allele for color and e the allele for eyes)

DIA [1.3K]2 years ago
4 0

Answer:

i cant see the genotypes listed but from what i can tell it will be

Gp, Twoone

G=green

p=purple

Two=two eyes

one= one eye

Starting with capitol = Dominant

Starting with lowercase = recessive

You might be interested in
14. A(n)
pashok25 [27]

Answer:

point mutation

Explanation:

3 0
2 years ago
the phone ringing is an example of a/an: a. extinction. b. stimulus generalization. c. stimulus discrimination. d. discriminativ
vagabundo [1.1K]
I think the answer is stimulus generalization
3 0
3 years ago
____________________ treatment is the oral administration of radioactive iodine to destroy thyroid cells.
Drupady [299]

Answer: RAI

Explanation:

4 0
1 year ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
2 years ago
Maddy, Carole, and Maria are enjoying a day at the beach. They are body surfing and playing on their boards. Imagine that wave A
Nuetrik [128]
When the two waves meet, there are two possibilities:

1.If the waves were both in phase and moving in the same direction, then, the amplitude will double, this is called constructive interference.
2. If the two waves were exactly out of phase, then they will try to move the water surface in all directions, thus, no movement and the waves cancel out. This is called destructive interference.
4 0
3 years ago
Other questions:
  • How have humans changed the atmosphere of the planet in the past 200 years?
    11·1 answer
  • How are codominant alleles and incompletely dominant alleles similar how are they different?
    12·1 answer
  • The chromatin becomes visible as chromosomes in which phase?​
    7·1 answer
  • Which of the following factors contributes to reemerges of disease more than the appearance of a new disease?
    8·2 answers
  • A "limiting factor" is something that limits the number of organisms that a certain ecosystem
    15·1 answer
  • The pituitary gland is the bodys master gland true false
    13·2 answers
  • Which statement is correct about how muscles move bones?
    5·2 answers
  • What is the main disadvantage of a flat map?
    8·1 answer
  • Helphelphelp i accidentally blocked out c and d on my last one
    6·1 answer
  • On what basis are minerals divided into groups?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!