1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mash [69]
3 years ago
5

Why does Osmosis affect plant and animal cells differently?

Biology
1 answer:
Tema [17]3 years ago
8 0

B. Plant cells have a cell wall, so they become turgid, or swollen, instead of bursting.
You might be interested in
Which of the following is a form of active transport?
scoundrel [369]
Active transport requires energy when moving molecules against a concentration agent. It requires for specific membrane transport proteins. Only a certain type of protein can move a certain type of substance. 

The three main types of Active Transport are:
1) Sodium-Potassium Pump
2) Endocytosis
<span>3) Exocytosis  </span>
6 0
4 years ago
Which type of blood vessel usually carries oxygen-rich blood
zalisa [80]

Answer:

Arteries

Explanation:

There are three main types of blood vessels: veins, arteries, and capillaries. Arteries are the blood vessels that carry the oxygenated blood from the heart to various body parts. Veins pick the deoxygenated blood and deliver it to the heart to be oxygenated.  

Arteries are the blood vessels with thick walls and no valves. Blood is pumped with higher pressure from the heart into arteries. The pulmonary artery is the only exception that carries deoxygenated blood from the right ventricle to the lungs for oxygenation.  

5 0
3 years ago
How are stars classified?
RUDIKE [14]

Answer:

Stars are classified by their spectra (the elements that they absorb) and their temperature. There are seven main types of stars. In order of decreasing temperature, O, B, A, F, G, K, and M.

Explanation:

O and B stars are uncommon but very bright. M stars are more common but dim.

3 0
3 years ago
Read 2 more answers
A pathogen is always
Ivahew [28]
Pathogens are disease causing agent
5 0
4 years ago
Read 2 more answers
NEED ASAP I'M TIMED!!
-BARSIC- [3]

The improvement of nutritional quality, economic resources, the production of crops, and the marketing of crops.

The improvement of nutritional quality will help make better crops so that they turn out beautiful.

Economic resources helps make the crops so that you have a ton of crops.

The production of crops will help with more sustainable farming.

The marketing of crops will help you with getting money and to afford for making more crops next year.

5 0
4 years ago
Other questions:
  • Similar cells that are grouped together and perform a common function are called
    5·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • HELP PLEASE ASAP Explain the advantages gained by studying plants using the groups and classifications commonly used by commerci
    11·2 answers
  • In what types of matter does convection occur
    12·1 answer
  • How is Taxonomy classification and biodiversity related ?
    12·1 answer
  • Which of the following is an inorganic compound ?
    9·1 answer
  • The process by which an original species is transformed into a new species over an extended period of time that spans many gener
    7·1 answer
  • 11. Fossil fuels are considered nonrenewable resources because of -
    9·2 answers
  • Who developed virtually the same theory of evolution?
    11·2 answers
  • What is the basic unit of classification and is denoted by a unique two-part scientific name?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!