Answer:
This question lacks options, the complete question is: What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell, or a harmful mutation in an adult multipotent stem cell?The correct answer is a harmful mutation in a pluripotent embryonic stem cell.
Explanation:
Pluripotent Stem Cells can self-renew and differentiate into any of the three germ layers, which are: the ectoderm, the endoderm and the mesoderm. These three germ layers subsequently differentiate to form all the tissues and organs within a human being. If during embryonic development, genetic mutations - alterations in genes - occur in the embryonic stem cell, they pass to daughter cells as a consequence of cell division, and an individual is generated whose cells differ at the genetic level. Multipotent stem cells are organospecific cells, that is, they can give rise to any type of cells but from a specific organ (a lung, a kidney or the brain). Their differentiation ends the moment they specialize and become a cell with a specific function within a specific tissue or organ. If there were a mutation in these cells, it would damage a specific designed tissue or organ.
Answer:
A GMO Genetically Modified Product though similar to cloning is quite different. Cloning is the process of using egg cells from an individual to produce a new organism. When the baby is born, it is genetically identical to the parent, an exact copy. This process occurs in a lab. Genetic Engineering, which is used to make GMOs, uses technology to alter or change an organism's genes. New genetic information can be added to or removed from an existing set of DNA.
<em>So I would say that some of the differences between GMOs and cloning include that:</em>
Cloning strives to create exact copies of an organism's parent while GMOs remove and add different genes to form desired offsprings like making a product last longer or making the product grow larger faster.
Hopefully, this helped you! Have a nice day :)
Explanation:
Which process is a physical change?
c. melting ice
If you break a piece of glass, the shape of the glass changes, but the properties in the fragments remain the same. Which of the following has occurred?
d. a physical change
A substance made up of two or more elements that have been chemically combined is called
c. a compound
Of the three ordinary states of matter, gas is the only state that
c. is highly compressible
In which state of matter do the particles have the most energy?
b. gas
Elements in group 18 called Noble Gases are highly reactive because they have 1 valence electron.
false
Atomic mass is the sum of
b. protons and neutrons
The current model of the atom is known as
a. Rutherford's model
Most elements on the periodic table are
d. metals
Which is not a quality of a non-metal?
a. shiny
Hope this helps.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
B. Ice gains heat becomes liquid, gains more heat, and forms a gas.
Explanation:
