All categories

3 years ago

Please complete the following DNA strands

1 answer:

5 0

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

You might be interested in

In man, assume that spotted skin (S) is dominant over non-spotted skin (s) and that wooly hair (W) is dominant over non-wooly ha

Brut [27]

Answer:

Total four genotypes and its frequency

SsWw – 4/16

ssWw- 4/16

Ssww - 4/16

ssww - 4/16

Phenotype –

SsWw – Heterozygous Spotted skin and heterozygous wooled hair

ssWw - Homozygous non-spotted skin and heterozygous wooled hair

Ssww - Heterozygous Spotted skin and Homozygous non -wooled hair

ssww - Homozygous non-spotted skin and Homozygous non -wooled hair

Explanation:

Given -

Allele for spotted skin is "S"

Allele for non-spotted skin is "s"

Allele for Wooly hair is "W"

Allele for non-wooly hair is "w"

Allele "S" is dominant over "s"

And Allele "W" is dominant over "w"

Cross is carried out between heterozygous spotted, non-wooly man and heterozygous wooly-haired, non-spotted woman

Genotype of heterozygous spotted, non-wooly man - Ssww

Genotype of heterozygous wooly-haired, non-spotted woman - ssWw

Ssww * ssWw

Sw Sw sw sw

sW SsWw SsWw ssWw ssWw

sw Ssww Ssww ssww ssww

sW SsWw SsWw ssWw ssWw

sw Ssww Ssww ssww ssww

Total four genotypes and its frequency

SsWw – 4/16

ssWw- 4/16

Ssww - 4/16

ssww - 4/16

Phenotype –

SsWw – Heterozygous Spotted skin and heterozygous wooled hair

ssWw - Homozygous non-spotted skin and heterozygous wooled hair

Ssww - Heterozygous Spotted skin and Homozygous non -wooled hair

ssww - Homozygous non-spotted skin and Homozygous non -wooled hair

8 0

4 years ago

Adenosine triphosphate (ATP) is the energy currency of a cell. All of the following statements regarding ATP are true expect one

creativ13 [48]

Adenosine triphosphate (ATP) is a cell's energy currency. All of the following statements about ATP are true, except ATP is used to lower activation energy in enzymatic reactions.

A) ATP is used to lower the activation energy in enzymatic reactions.

<h3>How does ATP affect enzyme activity?</h3>

Enzymes allow chemical reactions to proceed with activation energy provided by the catabolism of ATP. When cells convert glucose and oxygen into carbon dioxide and water, they use 2 molecules of ATP as activation energy and gain 36 to 38 molecules of ATP in return. Without enzymes, this would not be possible.

Learn more about ATP in brainly.com/question/14637256

#SPJ1

4 0

1 year ago

Plantas de herbolaria mexicana que usamos para calmar problemas digestivos??

Igoryamba

Manzanilla, hinojo, menta puperita, melisa, regaliz, jengibre

8 0

3 years ago

Animals which have the ability to determine the survivability of other

kramer

Answer:

scientist has brought together all the research on the subject and found that, from bees to birds to wolves, many animals have an ability to process and represent numbers arguably a form of counting.

Explanation: What's more, the new study suggests that this mathematical prowess helps animals stay alive in a brutal world. Such a finding extends our knowledge of animal cognition, a field that has grown exponentially in recent years.

8 0

3 years ago

What is the control center of the entire nervous system ?

notka56 [123]

The brain and the spinal cord.

6 0

3 years ago