1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
3 years ago
10

Please complete the following DNA strands

Biology
1 answer:
Mars2501 [29]3 years ago
5 0
1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)
You might be interested in
Why is succession slower on sand or bare rock than on previously vegetated soil exposed by a fire?
andrew-mc [135]

Answer:

nutrients in the ground and the new life that approaches that territory tend to start everything over cause sand and bare rock doesn't have a lot of biodiversity

Explanation:

8 0
3 years ago
Please answer the following questions
krok68 [10]

Answer:

h and I am I the only one mad about this I waited a month for the folks in the back of my mind that I was like and I was like you were the only way to go with the kids to 3rd grade and I would have a nice time and a few more people to take cash behind and to get rid of the members of the group don't know how to get rid of the problem of a problem with a joke or another that you may not have seen as well I would love it to the future and to get rid of it as soon as I can come over to the house tomorrow morning and then I will be there for you and your wife

5 0
3 years ago
Creating new things to solve problems and improve life depends on the close interaction of which two fields?
pishuonlain [190]
A is the answer to ur question
4 0
3 years ago
Read 2 more answers
Introduction: In 1915, a German scientist named Alfred Wegener proposed the theory of continental drift. According to this theor
nexus9112 [7]

Answer:

Pangaea, which looked like a C, with the new Tethys Ocean inside the C, had rifted by the Middle Jurassic, and its deformation is explained below.

Explanation:

6 0
3 years ago
Why is there so much variety of bacteria in the mouth
Alex
Hello

It is because ur mouth is a dark and warm place which is the perfect environment for bacteria to grow and survive. It doesn’t matter if u brush it really well on ur tounge there and groves in ur tounge where the toothbrush bristles cannot reach and clean so that is where the bacteria lives.

Hope this helps
Plz mark me as Brainliest
3 0
3 years ago
Read 2 more answers
Other questions:
  • How does a microscope help scientists observe objects?
    5·2 answers
  • • What is the Doppler Effect? How can the Doppler Effect be useful for a forensic investigation involving a shooting? • If you f
    8·2 answers
  • Huntington’s disease is due to an autosomal dominant allele. If a heterozygous male marries a normal female, what percentage of
    10·1 answer
  • What are some strategies that can help erin identify high-fiber whole-grain foods when she shops?
    14·1 answer
  • Why is the term "cell theory" appropriate? why is the cell theory a theory
    7·2 answers
  • [100 POINTS]
    6·1 answer
  • What level in the hierarchy of biological organization are lipids, a class of organic compounds? Select the correct box.
    14·1 answer
  • Which of the following is not part of the nucleotide structure?
    11·1 answer
  • You studied the body of someone who died in their sleep and found that your assistant accidentally left the body facedown while
    10·2 answers
  • Someone please answerrrr
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!