1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
3 years ago
15

What organ systems are involved when running?

Biology
2 answers:
Lesechka [4]3 years ago
8 0

Answer:

The Cardiovascular System, The Muscular System, The Nervous System, The Respiratory System, and The Skeletal System.

Explanation:

These are the systems that are involved because during running your heart, bones, muscles, brain, and lungs are the main parts in the activity.

Just so you know, there might be a few more that I missed, but I think I got them all.

djyliett [7]3 years ago
7 0

Answer:

There are many different organ systems that are involved in when we exercise. The three main ones are the respiratory system which is involved in breathing, the circulatory system which circulates blood flow throughout the body and lastly the muscular system, as you use muscles when you are moving.

Explanation:

<em>I would appreciate brainliest, if not that's ok!</em>

You might be interested in
If global warming continues, global average temperature could rise by 4ºC by the end of the century. Which of the following effe
valkas [14]

Answer:. Warmer ocean temperatures will result in stronger hurricanes

Warmer air temperatures will cause greater precipitation, which will decrease wild fire risk.

Explanation:

8 0
3 years ago
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
CELL PROJECT BIOLOGY​
tangare [24]

Answer:

What are we supposed to do? Add a question and the picture is blurry. And if you gogle your project and look at some websites and images similar things with pop up.

Explanation:

7 0
3 years ago
What statement describes the relationship between the deer and the bear and the food web?
zhuklara [117]
The correct answer is B. Heterotrophs compete from the same food.

Deer is the autotrophs. This is because it gets food from the bear and that dear can make its own food. Bear is the heterotroph it cannot provide food for itself. 

It acts as a consumer to deer. Organisms which produces complex organic compounds for example fats, proteins, and carbohydrates from simple substances which are present in the surrounding, are autotrophs.
5 0
3 years ago
Read 2 more answers
Helppppppppppppppp lls
xeze [42]
Answer is A. arranged in regular, repeating patterns
4 0
3 years ago
Other questions:
  • Which phrase best describes cellular respiration?
    7·1 answer
  • What are the economic impacts of any of the parasitic crustaceans on any of the commercial or sport fisheries?
    11·1 answer
  • Astronomers believe distant planet could be ‘more hospitable’ than earth. true or false
    9·1 answer
  • The observation that abnormal cleavage of mannose residues from glycoproteins causes an autoimmune disease in mice supports the
    14·2 answers
  • At which point is crust neither created nor destroyed?
    6·2 answers
  • ! The question is in the attached below, thank you for helping. Please so type random things or idk just to get pints . I will r
    15·2 answers
  • The physical interaction between the respiratory and the cardiovascular system takes place at which respiratory structure in a h
    10·1 answer
  • Which subatomic particle has a negative charge<br> Proton<br> Electron<br> Neutron<br> Atom
    15·1 answer
  • Pls help me on this I’ve asked 3 times already , biology ppl
    14·1 answer
  • 1Neurons are classified in several different ways. From the following statements, select which ones are true.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!