1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OleMash [197]
3 years ago
14

A tornado forms as a result of thunderstorms, so tornadoes would most likely be found in a location where-

Biology
2 answers:
schepotkina [342]3 years ago
8 0

The answer is C: warm, moist air meets a cool, dry air mass

Alex_Xolod [135]3 years ago
5 0

Answer: A

Explanation:

You might be interested in
Should guys with moobs wear bras in public?
krek1111 [17]
I think it’s up to them. But personally I don’t think it matters and I wouldn’t even be paying attention to that sorta thing.
7 0
3 years ago
Read 2 more answers
Which organelle allows bacteria to stick/adhere to surface or host cells
charle [14.2K]
I believe it’s attachment pili aka fimbriae.
5 0
3 years ago
Here is an image of the mitochondria. Mitochondria numbers can differ between cell types based on the function of the cell. Whic
ser-zykov [4K]
Answer: C) Muscle cell

Detailed Explanation:

Muscle cells contain the highest number of Mitochondria
6 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
After the swim meet, many cheeseburgers were eaten by a swim team of hungry kids.
xxTIMURxx [149]

Answer:

Lol! Also, what is the question? Or is there no question?

Explanation:

4 0
3 years ago
Other questions:
  • A specimen is 0.2 mm long. Calculate the length of its image if it magnified by 1000 times.
    7·2 answers
  • Proteins in the plasma membrane transmit signals inside the<br> cell.<br> True<br> False
    6·1 answer
  • How is globalization potentially damaging to the environment?
    10·2 answers
  • Scientists ask questions and develop hypotheses. After making what?
    15·1 answer
  • (Ignore the answer i chose I’m not sure if it’s right, which is the right answer?)
    12·1 answer
  • How would a block on the trade of these goods affect your life
    6·2 answers
  • What is the word for a sequence of steps used to define and solve a problem
    10·1 answer
  • The human hands and feet have similar types and numbers of bones. However, hands and feet are very different in their appearance
    13·1 answer
  • What is the function of hemoglobin in the body?
    5·2 answers
  • What is the difference between a mass extinction and a regular (background) extinction? (1 point)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!