The buoyant force is an upward force on an object submerged in a fluid. It is the resultant of the pressure force on the surface of the object. The buoyant force may be larger than the weight of the object causing it to accelerate upwards.
Answer:
DNA replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. ... Once the DNA in a cell is replicated, the cell can divide into two cells, each of which has an identical copy of the original DNA.
In the eukaryotic cell cycle, chromosome duplication occurs during "S phase" (the phase of DNA synthesis) and chromosome segregation occurs during "M phase" (the mitosis phase).
Explanation:
The water moves in the minute capillaries in plant roots, stem and leaves. The phenomenon of the movement of water in upward direction from the roots of the plant, up the stem and to the leaves is known as the capillary action.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
