1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
earnstyle [38]
3 years ago
7

Pls i need to know both number 5 first tyyyyyyy

Biology
2 answers:
Sav [38]3 years ago
8 0

Answer: number five is muscle

Explanation:

shutvik [7]3 years ago
8 0

Answer:

D. <em>Muscle</em>

Explanation:

Muscle tissue is the only one they would really have in common

*<em>hope I helped*</em>

You might be interested in
Which of the following best describes the solar radiation absorbed by and radiated from earth
KiRa [710]
I would say your answer is <span><span>The Earth’s surface is responsible for a small fraction of heat radiation to space</span>
</span>
3 0
4 years ago
Read 2 more answers
Malthus formed his theory by studying factors that control the population growth of humans. How might factors operating on organ
leva [86]
Malthus didn't account for diseases or natural disasters in his theory of population growth.
4 0
3 years ago
13. Air moving over the surface of the Earth:
Lynna [10]

Answer:

B

Explanation:

3 0
3 years ago
Explain how water makes its way to the leaves in the tops of the tallest trees against the force of gravity. Name what the climb
mart [117]

Answer: Capillary action occurs because water is sticky, thanks to the forces of cohesion (water molecules like to stay close together) and adhesion (water molecules are attracted and stick to other substances).

It reminds me of naruto

3 0
3 years ago
Can you identify how chemicals cycle in an ecosystem?
natulia [17]
Nutrients move through the ecosystem<span> in biogeochemical </span>cycles<span>. A biogeochemical </span>cycle<span> is a circuit/pathway by which a </span>chemical<span> element moves through the biotic and the abiotic factors of an</span>ecosystem<span>. It is inclusive of the biotic factors, or living organisms, rocks, air, water, and </span>chemicals<span>.</span>
7 0
4 years ago
Other questions:
  • What happens to the human body when the hart rate increases
    6·2 answers
  • Which of the following is the most serious effect of water pollution for humans?
    14·2 answers
  • What are two limits to cell growth
    15·1 answer
  • Which of the following has mechanical energy? bouncing ball water in a reservoir book on a table person running falling tree
    7·2 answers
  • How many and what are the processes that seed plants use to reproduce.
    6·1 answer
  • HELP
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Hello! I have a question and I ask if you can make it a bit detailed. I am struggling to understand the Calvin Cycle in the proc
    9·1 answer
  • 7. Once anaerobic respiration takes place, are the effects permanent? Why or why not?
    8·1 answer
  • What evidence suggests that proteins are synthesized and modified in the rough er as opposed to the smooth er?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!