Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer: yes I do believe the break up of peagaea had to do with the mass extinctions of some dinosaurs in such as the environment had changed for some and they weren’t able to cope it, it can also be the lack of food sources and predators. However with the Pangea there were new species of dinosaurs that had evolved which gave them a better survival then the first generations of dinosaurs when peangea was just started to appear
Explanation:
<span>Answer A is correct because humans release tons of chemicals into the environment every single day. All it takes to disrupt an entire ecosystem is a chemical released into their water source, which in time slowly poisons the animals. Say a rabbit was drinking the polluted water and is now carrying the poison in it's body. A coyote comes along and eats the poisoned rabbit, and the coyote is now poisoned. That threw off the natural food chain.</span>
Mass effects energy in a law called. kinetic energy and potential energy. The higher the mass the greater the energy
