Answer:
b
Explanation:
cuz that is what they normally eat so sorry if it's wrong
Answer:
Faster in Bath 2 as molecules collide more frequently in Bath 2 that Bath 1 .
Explanation:
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
DNA was first identified by Friedrich Miescher<span> in 1869 at the University of Tübingen.</span>
It's answer d, but for info :
The question of wether or not a virus is alive is not resolved, some scientists say yes, some say no.
The fact is, viruses need another organism's enzymatic machinery to survive : alone, they cannot multiply or grow, produce or use energy, functions that are common to everything alive.
On the other hand, they do possess nucleic acids and proteins like living beings!
