1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
steposvetlana [31]
2 years ago
15

Which of the following is the most important process specific to land dwelling plants

Biology
2 answers:
Ivenika [448]2 years ago
7 0

The correct answer is option A

The most important feature of the plants is the production of photosynthesis pigments that aids in the process of photosynthesis.

The specific characteristics of terrestrial plants is the process of photosynthesis which is done by the pigments present in the green plants.

Chlorophyll is only present in  green plants and is the most specific feature of land dwelling plants.

disa [49]2 years ago
5 0
A //////////////////////////////// is the right answer
You might be interested in
How do you find out if something is alive or dead?
balu736 [363]

Answer:

In order for something to be classified as living, it must grow and develop, use energy, reproduce, be made of cells, respond to its environment, and adapt. While many things meet one or more of these criteria, a living thing must meet all of the criteria.

3 0
2 years ago
I need help on this elmayo
strojnjashka [21]

Answer:

what

Explanation:

6 0
2 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What is 1+1+1+1+1+1+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+
Lana71 [14]
That would be 564 pls give me brainliest :)
3 0
3 years ago
Read 2 more answers
24. An investigator examines voltages resulting from changes in membrane permeabilities. If the cell membrane suddenly had 100 p
omeli [17]

Answer:

Generally, K+ ions ensures re-polarization of  the membrane potential. It always ensures that the neuron returns its resting  state, protecting the  neurons and ensuring episode of rest before the next action potential.

K+ does this by leaving the axon, making the inner layer more negative. This is resting membrane potential. Because there are many K+ channels for leakages out of the neuronal axons.

Therefore, in this scenario, he neuron will return to its resting membrane potential state which between values -50 to -75mV.

Therefore the value of the potential will be -60mV, or within the range of -50 to -60mV. This is because the neuron is is non- excitable.

Explanation:

7 0
2 years ago
Other questions:
  • In a test of the effectiveness of garlic for lowering cholesterol, 48 subjects were treated with garlic in a processed tablet fo
    7·2 answers
  • Systolic pressure is the pressure in the arteries when the ventricles are contracting, while diastolic pressure is the pressure
    12·1 answer
  • White sands national monument is a large area made of white sand dunes. What is likely to be true of this area
    13·2 answers
  • What does a "fluid" environment suggest about an environment?
    5·2 answers
  • A neuron in the skin detects tissue damage in the skin during a burn and informs the brain and spinal cord. This neuron is part
    5·1 answer
  • If the base sequence on a separated DNA strand is CGTAGG, what will the base sequence on its complementary strand be?
    13·1 answer
  • How are chromosomes best described during the s phase of interphase prior to mitosis?
    6·1 answer
  • A metamorphic rock can also be thought of as a rock that changed. What causes the rock to change?
    6·1 answer
  • The colour of chameleon is not it beauty but for what purpose​
    14·1 answer
  • A. Modified TRUE or FALSE: Write TRUE if the statement is correct. Otherwise, change the underlined word/phrase to correct the s
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!