1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
3 years ago
7

Which type of reaction is NACI plus a GNO32NANO32AGCI

Biology
1 answer:
son4ous [18]3 years ago
4 0

Answer:

double displacement reaction

Explanation:

i hope that helped

You might be interested in
Before mitosis begins, a cell makes a copy if all the DNA in each chromosome. What would go wrong if a cell did not make a secon
skelet666 [1.2K]

Answer:

look it up

Explanation:

if y'all paid attention in class y'all would know like honestly y'all are lazy do some research

7 0
3 years ago
(oxygen, electron transport chain, chemiosmosis, NADPH)
Vaselesa [24]

Hai there :3 I'm planning to study chemical engineering.

Question related to Biochemistry (Photosynthesis & Cellular Respiration)

1. Chemiosmosis.  In the process of chemiosmosis, specific enzymes (such as ATP synthase) create ATP. Hydrogen ions go from a higher proton concentration to a lower one, which is why it's called chemio"osmosis"

2. Electron Transport Chain (ETC). The name says it all. Simply explained, electrons are transported and transferred in the mitochondrial membrane.

3. Oxygen. O2, the diatomic molecule, is essential in respiration. In the final stage of respiration, at the near end of the electron transport chain, oxygen accepts protons to become water. Cells use O2 during oxidative phosphorylation.

4. NADPH. I remember learning what this acronym means by heart. Nicotinamide Adenine Dinucleotide Phosphate Hydrogen. NADPH is essential in photosynthesis as a typical coenzyme in the reduction of chemical reactions.

6 0
3 years ago
A healthy ecosystem can be sustained and function successfully over a long period of time. How can a reduction of resources affe
sattari [20]

Answer:yo momma

Explanation:

8 0
3 years ago
1. All eukaryotic cells contain small<br> structures called
ozzi

Answer:

oganelas

Explanation:

4 0
3 years ago
What's the name of the black hole region that creates the gravitational force holding the Milky Way together?
scoundrel [369]

Answer:

Sagittarius A*

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Plants perform cytokinesis differently than animals because
    12·1 answer
  • Ash from a volcanic eruption decreases the amount of available solar energy for a region. How will a decrease in available sunli
    5·2 answers
  • Which type of monkeys do humans resemble? Explain.
    8·2 answers
  • Give three reasons how ionic and covalent bonds are different
    9·2 answers
  • The effect of a hormone on a target cell may be decreased by the presence of ________.
    12·2 answers
  • Which of the following adaptations in wooly mammoths could have best prevented their extinction?
    9·2 answers
  • How many variables should you have in a control experiment?
    15·2 answers
  • Which organ is responsible for dehydration and compaction of indigestible materials?
    5·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Who can answer this question
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!