1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga55 [171]
3 years ago
6

The diagram shows a football field that represents a geological time scale. Why are no organisms labeled between the end zone an

d 30 yard line on the left side of the field? Scientists disagree about the fossils from this time period. Scientists have not studied that part of the time scale. There is very little fossil evidence for this time period. There are too many fossils to name.
Biology
2 answers:
const2013 [10]3 years ago
8 0

Answer:

b

Explanation:

boi

avanturin [10]3 years ago
6 0

Answer:

the is b

Explanation:

You might be interested in
Which of the following statements is true about the nature of light?
Ksivusya [100]

Answer:

B

Explanation:

Light shows duality i.e it shows properties of both particle as well as wave.

8 0
3 years ago
Read 2 more answers
In algae, cyanobacteria, and plants, chlorophyll a absorbs all colors of light except for
kakasveta [241]
B. Green


Chlorophyll is found in and around the photosystems embedded in the thylakoid membrane of the chloroplasts.

The chloroplasts are organelles found in eukaryotic algae. The chloroplasts in eukaryotic celss are contained in the cytoplasm together with other organelles.

<span>Since the chlorophyll is insided the chloroplast which is inside the cytoplasm, it is safe to say that the chlorophyll of the green algae is spread throughout the cytoplasm of its cells.</span>
4 0
4 years ago
Read 2 more answers
Which part of a molecule provides energy for life process
son4ous [18]
Adenosince Triphosphate is broken down into one molecule of inorganic phosphate and a molecule of adenosine diphosphate, the energy released from this bond is captured and use to drive most cellular processes. some form of carbohydrate or triglyceride is used to generate the ATP in the first place depending upon a particular species and needs at the time
7 0
3 years ago
Other photo for bill he video
seropon [69]
Where is the phot for the video?
5 0
2 years ago
Which pair of scientific fields would be most useful in investigating human
ella [17]
I would say D! Purely because it is looking at the effects of humans (therefore related to topics more geographical).



Hope that helps. :)
6 0
2 years ago
Other questions:
  • The specific molecular changes that occur when a drug binds to a particular target site or receptor are referred to as
    5·1 answer
  • Why is is lt important to protect earths water,land,and,air recources?
    14·1 answer
  • What class of barrier to gene flow would we be observing if we noted that the offspring of a lion and a tiger (two different spe
    11·1 answer
  • Please help on the first one that talks about the moon
    14·1 answer
  • Where is the flow of energy from the earth interior observable and measurable without sensitive scientific equipment
    10·1 answer
  • Why would freezing a balloon full of air causer to shrivel
    7·2 answers
  • What do mutations bring about
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • PLEASE HELP!!! 57. One strand of a DNA double helix has the base sequence ACGTAATCGCCG. What would be the
    11·1 answer
  • What is a DNA fingerprint? (FORENSICS)
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!