1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nadusha1986 [10]
3 years ago
9

What is the diploid number of daughter cells

Biology
2 answers:
Ludmilka [50]3 years ago
5 0

Answer:

2

Explanation:

During mitosis, the parent, diploid (2n), cell is divided to create two identical, diploid (2n), daughter cells.

kicyunya [14]3 years ago
4 0

Answer:

<h2><em>2</em></h2>

Explanation:

~ It's during Mitosis

A <em>Monovalent chromosome</em><em> </em>is duplicated so that it will have two DNA strands that are replicas of each other.

<em>~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~</em>

<em>GL.</em>

You might be interested in
What part of a cell membrane is usually in contact with the interstitial fluid?
Akimi4 [234]
I believe the answer to your question would be:
<span>phosphate heads of phospholipid</span>
8 0
4 years ago
Help with all please
anzhelika [568]

1. D. observations

2. A. The egg rolled off the kitchen counter.

3. B. prediction

5 0
3 years ago
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
Which part of the brain processes inputs received from the cerebral motor cortex, brain stem nuclei, and various sensory recepto
a_sh-v [17]
The answer is cerebellum. By processing and interpreting impulses from the motor cortex and brain stem nuclei as well as sensory pathways, the cerebellum provides the precise timing and appropriate patterns of skeletal muscle contraction for smooth coordinated movements and agility needed for daily living. It also plays a poorly understood role in cognition. Cerebellar activity occurs subconsciously (e are not aware of it).
<span />
5 0
3 years ago
Read 2 more answers
What does it mean if a population is in Hardy-Weinberg equilibrium? Be specific.
Andrej [43]

Answer:

The Hardy-Weinberg law states that in a sufficiently large population, in which matings occur randomly and that is not subject to mutation, selection or migration, gene and genotypic free frequencies are kept constant from one generation to another, once a state of equilibrium has been reached, which in autosomal loci is reached after one generation.

It is said that a population is in equilibrium when the alleles of the polymorphic systems maintain their frequency in the population throughout the generations.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following statements is true? Very fertile soil is found near the top of a mountain. Moisture is the least importan
    6·2 answers
  • What is the structure of hemoglobin and how is oxygen bound to it?
    5·2 answers
  • The name of the technique used to alter the genetic makeup
    7·1 answer
  • What are the 4 chambers of a sheep's stomach ?
    12·1 answer
  • ________ is a technique that involves putting a healthy copy of a gene into cells that have a defective copy of the same gene.
    9·1 answer
  • Consider all the different types of cells mentioned in this activity that participate in the immune response. which cells are re
    12·1 answer
  • Which part of society uses the<br> greatest amount of available<br> freshwater?
    10·1 answer
  • Lindeman developed a classification of organisms based on
    5·1 answer
  • Topographic map triangles represent
    8·1 answer
  • Which statement describes how this
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!