<u>A (they belong to the same group of the periodic table)</u>
<u></u>
The answer is A because C doesn't have a causal relationship, D doesn't strongly effect most chemical properties, and chemical properties remain unchanged with state of matter.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Hypotheis:
<em>If high amounts of product in the samples, '+++' , correlates with optimal temperatures and pH for enzyme activity, then...</em>
- <u>A- Pepsin</u>
- <u>B- Amylase </u>
- <u> C- thermophilic enzyme</u>
Explanation:
Enzymes are specialized proteins that function as biological catalysts- <u>they speed up chemical reactions.</u> As proteins, these are susceptible to changes in temperature and pH- they function best at optimal values for both conditions, but can be denatured, rendering them inactive at relative extremes.
Each enzyme provided has its own optimal temperature and pH values.
- Thermophilic enzymes are usually found in regions characterized by high temperatures. They show high thermostability, and do not become denatured at high temperatures- they thrive, and do not function well at lower temperatures.
- Amylase is a hydrolase digestive enzyme found in the mouth, that acts on polysaccharides like starch to break 1,4 glycosidic bonds between glucose molecules. It works best at a physiological (neutral) pH and temperatures (around 37°)
- Pepsin, another digestive enzyme, is a peptidase that breaks down proteins into peptide molecules. It is found in the stomach lining, where the pH is typically low i.e. acidic due to the hydrochloric acid in digestive juices.
Thus from the table A- pepsin, B- Amylase and C- thermophilic enzyme can be hypothesized.
Answer:
cognitive therapy is a type of psychotherapy to treat human mood disorders such as depression.
hope it helps!