1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nordsb [41]
2 years ago
15

Why doesnt it rain much in east ferris

Biology
1 answer:
aivan3 [116]2 years ago
8 0

Answer:

When it is cold higher up, the water molecules in water vapor come together; the water vapor becomes liquid water, which then falls as rain When the air gets to East Ferris, there is not enough water left in it to fall as rain. East Ferris people use too much water and do not recycle.

You might be interested in
Why might two elements possess similar chemical properties?
Studentka2010 [4]

<u>A (they belong to the same group of the periodic table)</u>

<u></u>

The answer is A because C doesn't have a causal relationship, D doesn't strongly effect most chemical properties, and chemical properties remain unchanged with state of matter.

7 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
I need to know the hypothesized enzyme
worty [1.4K]

Answer:

Hypotheis:

<em>If high amounts of product in the samples, '+++' , correlates with optimal temperatures and pH for enzyme activity, then...</em>

  • <u>A- Pepsin</u>
  • <u>B- Amylase </u>
  • <u> C- thermophilic enzyme</u>

Explanation:

Enzymes are specialized proteins that function as biological catalysts- <u>they speed up chemical reactions.</u> As proteins, these are susceptible to changes in temperature and pH- they function best at optimal values for both conditions, but can be denatured, rendering them inactive at relative extremes.

Each enzyme provided has its own optimal temperature and pH values.

  • Thermophilic enzymes are usually found in regions characterized by high temperatures. They show high thermostability, and do not become denatured at high temperatures- they thrive, and do not function well at lower temperatures.
  • Amylase is a hydrolase digestive enzyme found in the mouth, that acts on polysaccharides like starch to break 1,4  glycosidic bonds between glucose molecules. It works best at a physiological (neutral) pH and temperatures (around 37°)
  • Pepsin, another digestive enzyme, is a peptidase that breaks down proteins into peptide molecules. It is found in the stomach lining, where the pH  is typically low i.e. acidic due to the hydrochloric acid in digestive juices.

Thus from the table A- pepsin, B- Amylase and C- thermophilic enzyme can be hypothesized.

6 0
2 years ago
What is cognitive therapy
alexandr1967 [171]

Answer:

cognitive therapy is a type of psychotherapy to treat human mood disorders such as depression.

hope it helps!

4 0
2 years ago
Read 2 more answers
The gulf and the Dead Sea are extended of the same geological rift that resulted in the opening of the Red Sea is in which cardi
lora16 [44]

Answer:

East

Explanation:

East is the correct answer...

3 0
2 years ago
Read 2 more answers
Other questions:
  • Which type of cell stays dormant, waiting to differentiate in adults to replace damaged cells? A. Totipotent B. Multipotent C. P
    14·1 answer
  • use the samples; diamond, dolomite, gneiss, and chalk and provide your analysis of composition and identification based on their
    8·1 answer
  • A. Cellular Respiration – what type of reaction? ….and how much energy?
    9·1 answer
  • A cylinder with a mass of 12 g has a radius measuring 2 cm and a height of 6 cm. What is its density? 0.05 g/cm3 0.16 g/cm3 1 g/
    12·2 answers
  • The systems of the body work together and are dependent upon one another. Explain how another system, besides the skeletal syste
    6·1 answer
  • People playing basketball game in a gymnasium make up a closed system with 17,125 J of energy. At the beginning of the game, the
    10·2 answers
  • The difference in the concentration of a substance across a space is called a concentration...?
    13·1 answer
  • Why can the River Nile be seen from space?
    10·1 answer
  • During Mendel's second set of experiments, he allowed the F1, offspring from the first experiments to self-pollinate. Which of t
    13·2 answers
  • HELP!! PLEASE!!! 10 POINTS
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!