1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mamont248 [21]
3 years ago
13

Beneath a boat dock in the Red Sea, the silversides, the sponges, and the salt water make up which of the following? Select all

that apply.
a population

part of a community

part of an ecosystem​
Biology
1 answer:
Talja [164]3 years ago
7 0

Answer:

Part of a community

Part of an ecosystem

Pls mark Brainliest :)

Explanation:

You might be interested in
What source of energy drives the
Yakvenalex [24]

Answer:

Sun light

Explanation:

anwser A....

8 0
3 years ago
About 225 million years ago, North America and South American were part of one huge landmass, Pangaea.
Advocard [28]
This is not even a question. Is it a true or false question if so tell us.
8 0
3 years ago
Which of the following structures is NOT found in bacteria?
asambeis [7]
D nuclear membrane since bacteria is a prokaryote which means it does not have a nuclear membrane
3 0
3 years ago
Read 2 more answers
The primary means for transmitting messages between the brain and the rest of the body is the ______.
Nesterboy [21]

Answer:

The primary means for transmitting messages between the brain and the rest of the body is the <u>spinal cord</u>.

Explanation:

The spinal cord is the main pathway of the nervous system. The impulses are transmitted to the brain through bundles of ascending nerve fibers, while the descending fibers transmit impulses in the opposite direction. Signals are transported to and from different parts of the body along the fibers of the pair of spinal nerves, which form intersections with the spinal cord through their dorsal and ventral roots; the sensory and motor fibers converge in the gray matter of the medulla.

5 0
4 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • During the summer a warm, moist air mass moved over texas. this air mass probably originate over
    15·1 answer
  • In an experiment, what is the factor that is tested? control specimen hypothesis variable
    9·1 answer
  • What information cannot be studied effectively using human torso models? I. the approximate sizes of organs II. the textures of
    10·1 answer
  • A fatty acid that contains a chain of 10 carbons and one double bond is termed a:_____a. monounsaturated,medium chain fatty acid
    14·1 answer
  • Organisms that are the same species must also belong to the same what?
    9·1 answer
  • I WILL GIVE BRAINLIEST PLEASE
    10·1 answer
  • Match the chemical formula to the name of the compound.
    11·1 answer
  • Grasslands typically do not flourish when large herbivores are removed. In fact, they are soon replaced by broad-leaved herbaceo
    12·1 answer
  • What is the role of a ribosome in protein production?
    12·1 answer
  • 2018 liu comparative study of phrenic and partial ulnar nerve transfers for elbow flexion after upper brachial plexus avulsion a
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!