Answer:
Mitochondrial Disorder
Explanation:
The LHON stands for leber hereditary optic neuropathy is a type of mitochondrial disorder. The disorder is generally observed in young males. The mitochondrial disorder are transferred from mother to its progeny. The disorder causes retinal ganglion cells (RGCs) and the exons of RGCs to degenerate. The disorder causes sudden painless failure of vision. The disorder leads to loss of central vision, optic atropy and central scotoma.
The most of the individuals with LHON do not possess the signs of the disorder. The disorder is caused by mutation in maternal DNA, thus it is a type of mitochondrial disorder.
Answer/Explanation:
In humans, we breathe in oxygen via the respiratory system. The oxygen enters the lungs. The air sacs in the lungs - the alveoli - are the site of gas exchange in the lungs and are where the circulatory and respiratory systems interact.
The alveoli take in the oxygen, where it diffuses into the capillaries (circulatory system). Blood, which passes through the capillaries takes this oxygen to all the cells in the body. Oxygen binds to haemoglobin in red blood cells, which transport it around the body.
Additionally, blood also transports carbon dioxide back to the alveoli of the lungs, where it diffuses into the lungs and is expelled when we breathe out
Sand dunes or desert pavement
The Answer is (A)
Because the pesticide will kill off the bugs and weeds but will damage the soil so after the crops you have in the ground now just will not grow there again until 1 year after the pesticide has washed away
hope I helped
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
