1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
14

Help pwessssssssssss​

Biology
2 answers:
Alecsey [184]3 years ago
8 0

Answer:

It is Eris, a dwarf planet to but a bit bigger than Pluto, so the answer is D

Explanation:

ch4aika [34]3 years ago
8 0

Answer:

it is D

Explanation:

You might be interested in
Please help me I dont know the answer
Delvig [45]
Rh antigen.

The chart shows that for A and B antigen there is no reaction so the correct answer will be Rh antigen.
3 0
3 years ago
Why is succession important to healthy ecosystems
marishachu [46]
Ecological succession provides diversity and depth to a biotic community. Without it, life can not grow or progress. ... ( I don’t know if this will help you but here you go. )
3 0
3 years ago
Read 2 more answers
What is the most likely reason that a long beak could be an adaptation for a bird living in a temperature forest?
natita [175]
It probably needs to dig in the ground for worms and grub. So it's an adaptation for finding food.
7 0
3 years ago
Which part of the digestive system food is first mixed with an enzyme
Kryger [21]

Salivary amylase

Explanation:

In the tongue, salivary amylase is the first enzyme to mix with food in the digestive tract. It is the primary enzyme of saliva. Salivary amylase is secreted from the salivary glands (mainly parotid glands) in the buccal cavity.

<em> </em><em>Hope </em><em>it</em><em> helps</em><em> you</em><em>.</em><em>.</em><em>.</em><em> </em><em>Pls</em><em> mark</em><em> brainliest</em>

7 0
3 years ago
A. At the end of replication, two ____ copies of DNA exist.
Andrew [12]
The answer to your question is two DNA molecules. 2 both copies consist of one new chain and one old chain nucleotides. half of the chain is part of the original DNA molecule the other brand new molecule
4 0
3 years ago
Other questions:
  • A somatic cell from a garden pea normally contains 14 chromosomes. how many sister chromatids would that cell contain during g1
    5·1 answer
  • The lowest end of the continuum of intermediate sanctions is:
    12·1 answer
  • Any variation that can help an organism survive in its environment is called a(n):
    8·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Name for large bases containing two carbon-nitrogen rings
    15·1 answer
  • Scientific and technological discoveries are accepted if their evidence can be _____.
    11·1 answer
  • Florida seagrass has special roots to help it stay anchored in moving ocean water as adaptation to its marine environment. True
    8·1 answer
  • How to draw a human cell and lable it and not look cartoonish​
    14·1 answer
  • Reactions, such as cellular respiration, are known as:
    14·1 answer
  • According to caplan what community implication might follow from trafficking organs?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!