1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oxana [17]
3 years ago
8

Mrs. Rosales performed a demonstration of a chemical reaction for her science students. In a well-ventilated room, she added a s

ulfuric acid solution to a beaker containing granulated sugar. The mixture immediately became very hot and released water vapor into the air. The sugar appeared to burn and was transformed into a rapidly growing column of solid black material. The experiment also produced a foul-smelling odor. Which observation about the demonstration does not provide evidence of a chemical reaction? A. The mixture immediately became very hot B.Water vapor was released into the air. C.The mixture released a foul-smelling odor. D.The sugar was transformed into a solid black material​
Biology
1 answer:
Andrej [43]3 years ago
6 0

Answer:

D

Explanation:

You might be interested in
anxiety is the actual experience of apprehension and uncontrolled arousal and ______ anxiety is a personality characteristic, wh
Kipish [7]

Answer:

<u>State</u> anxiety is the actual experience of apprehension and uncontrolled arousal and <u>trait</u> anxiety is a personality characteristic, which represents a latent disposition to perceive situations as threatening.

Explanation:

<u>State anxiety:</u> It is basically a "right now" feeling which changes from moment to moment, manifesting itself as an interruption of an individual's emotion state, leading to a sudden superversion of emotional equilibrium, caused by external factors of current state. e.g An atheletes emotional state at any given time that is variable from situation to situation.

<u>Trait anxiety:</u> It is a personality disposition which is stable over time. e.g An atheletes disposition to interpreting a situation as threatning and responding with an increase in state anxiety.

5 0
3 years ago
Which sentences describe the differences between photosynthesis and cellular respiration
katrin [286]
The difference is that photosynthesis occurs in the chloroplasts and cellular respiration occurs in the mitochondria. Another difference is the reactants for photosynthesis are different than the reactants for cellular respiration. One more difference is in photosynthesis you capture Energy from the sun and change it into food and cellular respiration is the process by which cells use oxygen to break down food and produce.
6 0
3 years ago
Plz idk if it’s correct
kap26 [50]

Answer:

Yes you are correct.

Explanation:

Number one is the rough ER not the nucleus. Number 3 is the mitochondria not the Ribosomes. This is an animal cell so there can not be a cell wall. There are exactly 3 small vacuoles in an animal cell so yes, you are correct.

3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Penicillin-binding protein 2a, encoded by the medA gene, isn’t affected by beta-lactam antibiotics.
Flauer [41]

Answer:

The correct answer is - false.

Explanation:

Penicillin-binding protein 2a or PBPs are protein produced by bacteria that binds with the β-lactam antibiotics such as penicillin. They play role in the cell wall synthesis of bacteria by producing peptidoglycan by catalyzing the reaction.

β-Lactam antibiotics bind with the PBPs and cause the disruption to peptidoglycan cross-linking in the biosynthesis of the cell wall and ultimately lysis of bacteria takes place and cell death.

7 0
2 years ago
Other questions:
  • 70 year-old female patient presents with a complaint of right knee pain with weight bearing activities. she is also developing p
    6·1 answer
  • What is the first step in triggering a change in membrane potential?
    8·1 answer
  • The principle stating stating that the oldest rocks occur on the bottom of an undisturbed rock sequence is known as
    12·1 answer
  • The capacity of a stream is directly related to its _____.
    9·2 answers
  • Earth's Greatest Enemies?Climatologist James Lovelock(originator of theGaia_hypothesis ) once said that Earth's greatest enemies
    6·1 answer
  • When you exhale onto a cold window pane water vapor in your breath condenses on the glass. Where does the water vapor come from
    12·1 answer
  • The phase during mitosis when chromosomes line up in the center of the cell is:
    7·1 answer
  • Where did Watson and Crick do their work on Dna
    11·1 answer
  • What is Anaerobic respiration?
    9·2 answers
  • Can you help me please
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!