1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldi70 [24.7K]
2 years ago
14

Which optical phenomena are formed by ice crystals?

Biology
1 answer:
azamat2 years ago
6 0
Halo, any of a wide range of atmospheric optical phenomena
You might be interested in
Through which process do living organisms release carbon into the<br> atmosphere?
Kay [80]
Respiration is the answer
5 0
3 years ago
Read 2 more answers
Which answer choice has only biotic examples?
wlad13 [49]
Biotic Factors are any living components that affect other organisms, and since soil is not alive (soil is an abiotic factor) then you can eliminate A., B., and C. D is the answer choice that has only biotic examples. 
3 0
3 years ago
Read 2 more answers
Maintenance of normal intracellular fluid volume depends largely on the intracellular concentration of _____ ions.
kogti [31]

The answer is D. Extracellular, the main ions involve in osmoregulation in a cell are sodium and chloride. Intra-and extracellular distribution of K+ is influenced, for example, by Na+/K+-ATPase function, pH, Cellular catabolism and anabolism, Insulin and glucose. Parathormone and calcitriol are important in the homeostatic regulation of phosphates.






7 0
3 years ago
(SCIENCE)
Serjik [45]
A is your answer I believe because they do indeed provide a way to review other scientists work and or experiments
7 0
3 years ago
Read 2 more answers
Which symbols represent ions found in a glass of water
Paha777 [63]

Answer:

I just wrote a test I picked

Explanation:

OH_&H+ I will give you a feedback when I get my scripts

4 0
3 years ago
Other questions:
  • if cells are placed in pure water, will water will move intothe cells faster than it will move out of the cells?
    8·1 answer
  • QUESTION 1<br> You want to start a Word document. Which of the following is the BEST first step?
    6·1 answer
  • A scientist observes an enzyme polypeptide chain arranged in spiral turns that rise upward and are held in place by hydrogen bon
    6·2 answers
  • Science 7 Grade 7.
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Biology. Carbohydrates.
    13·1 answer
  • Explain how heredity plays a role in the traits we receive from our parents.
    6·1 answer
  • Now make a list of questions to guide you in your research. You should be able to answer these questions in your paper: What cha
    12·1 answer
  • What is the only evidence we can get from a star?
    8·1 answer
  • 9. Which substance is cut by
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!