1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kobusy [5.1K]
3 years ago
5

Anjuli performed an experiment to determine the respiration rate of yeast. She determined this by measuring the

Biology
1 answer:
Hitman42 [59]3 years ago
7 0

The correct answer is B. She was measuring a rate of change.

Explanation

A linear graph is a type of graph that contains a series of data represented by points joined by linear segments, which allow you to quickly check the change in the trend of the data. Therefore, inline graphs quantitative variables are usually used to see their behavior over time. According to the above, Anjuli had to use a linear graph to express the information in the graph more clearly, because the data that he was using in his graph were quantitative variables. Also, she wanted to express the respiration rate of the yeast per minute. According to the above, the correct answer is B. Ella She was measuring a rate of change.

You might be interested in
Please help me in this question.
Aleks [24]
I think the organisms will adapted to mitochondrial
3 0
4 years ago
What is the difference between climate and weather? If you’re not sure, take a guess.
vlada-n [284]
The difference between weather<span> and </span>climate<span> is a measure of time. </span>Weather<span> is what conditions of the atmosphere are over a short period of time, and</span>climate<span> is how the atmosphere "behaves" over relatively long periods of time.</span>
4 0
3 years ago
Read 2 more answers
What tissue surrounds the entire muscle and forms tendons?
VARVARA [1.3K]

Answer:

It would be the epimysium

Explanation:

7 0
3 years ago
It is difficult to define Primates according to the presence or absence of certain distinguishing anatomical or behavioral trait
Sunny_sXe [5.5K]

Answer:

The correct answer is - true.

Explanation:

Primates are the third diverse group of mammals after rodents and bats. It is considered that it has diverged from other terrestrial mammals about 65 million years ago.

Defining and identifying the primates on the basis of certain anatomical and behavioral traits is not an easy task. There are almost 400 living species of primates are known.

6 0
3 years ago
State the two components of natural capital.
Mademuasel [1]

Answer:

I think

Abiotic natural capital comprises subsoil assets (e.g. fossil fuels, minerals, metals) and abiotic flows.

Biotic natural capital or ecosystem capital consists of ecosystems, which deliver a wide range of valuable services.

Hope this Help!:)

8 0
3 years ago
Read 2 more answers
Other questions:
  • HELP Which situation would not encourage competition? Select one:
    11·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • When plants die and decay, they bring carbon into the soil true or false?
    10·2 answers
  • Tom is going to buy two hamsters. He wants to breed them and sell the baby hamsters to a local pet store. The store owner tells
    8·1 answer
  • Examples from your book describing real experiences of how memories, even ones from a long time ago, can be stimulated by locati
    14·1 answer
  • How is climate different from weather?
    5·1 answer
  • The process of the plasma membrane pumping excess sodium out of a cell into an environment where there is a lower concentration
    10·1 answer
  • 2. Describe sexual reproduction.
    6·2 answers
  • Is a echinodermata biodiverse
    8·1 answer
  • Which of the following is a function of lipids?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!