1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
9

Genetic variation is caused by _____ when homologous chromosomes exchange pieces of genetic information

Biology
1 answer:
balu736 [363]3 years ago
7 0

Answer:

mutation,recobmadation, and immitigation

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which is an example of a behavioral adaptation? Birds migrating in the winter a ducks's webbed feet a polar bears thick fur a ga
Mrac [35]
Birds migrating in the winter would be a behavioral adaptation. The rest of the adaptations would be structural or physiological because they are controlled by mutations in the DNA. <span />
3 0
3 years ago
Read 2 more answers
Both bacteria and amoeba are unicellular organisms. Bacteria are considered to be prokaryotes, whereas amoebas are considered to
puteri [66]
Both have a way to get rid of waste materials
8 0
3 years ago
BRAINLIESTT ASAP!!
pentagon [3]

Lunar Tides: the moon's gravitational pull on the Earth is strongest at this time, because it is closest, causing especially high and low tides.

Solar Tides: the sun's gravitational pull on the Earth is strongest at this time, causing especially high and low tides (although it's not as powerful as lunar tides).

Spring Tides: named for when the tides "spring" forward during New and Full Moon's, because of how strong/weak the moon's gravitational pull is.

Neap Tides: the tides are especially mediocre at this time, because the sun and moon are at a right angle and pulling in opposite directions.

Spring and Neap Tides occur twice every moon cycle, which lasts 28 days, so every two weeks.

https://oceanservice.noaa.gov/facts/springtide.html

3 0
3 years ago
Read 2 more answers
Which structure of a protein is the amino acid sequence?
olganol [36]
C:Primary cause i was asked this question and that is what the answer was

5 0
3 years ago
Read 2 more answers
Other questions:
  • 1. Nitrogen from the atmosphere must be converted into what molecule? What organisms add this molecule to the soil? ​
    8·1 answer
  • Rachel has a pessimistic attitude. She worries incessantly about things and can never seem to see the positive side of life. Acc
    14·1 answer
  • Chewing a bite of bread mixes it with saliva and facilitates its chemical breakdown. This is most likely due to the fact that __
    6·1 answer
  • Does high temperature increase or decrease water supply?
    14·1 answer
  • Centromeres split apart during .
    14·2 answers
  • Evelyn bean, 52 years of age, is admitted to the same-day surgery unit for an elective laparoscopic cholecystectomy. the patient
    5·1 answer
  • Cancer cells do not respond to signals
    12·1 answer
  • Where does the process of transcription begin?
    6·1 answer
  • Auxins are plant hormones that coordinate several aspects of root growth and development. Indole-3-acetic acid (IAA) is an auxin
    13·1 answer
  • Which of the following does NOT belong as a characteristic of Eukaryotic cells?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!