1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katena32 [7]
3 years ago
13

Is the sequence of a dna strand is AAGCCA what are the bases on its complementary strand

Biology
1 answer:
iragen [17]3 years ago
4 0
TTCGGT! Hope this helped
You might be interested in
A unicellular organism with no nucleus is a
Vlad [161]

Answer:

Prokaryote

Explanation:

a microscopic single-celled organism that has neither a distinct nucleus with a membrane nor other specialized organelles. Prokaryotes include the bacteria and cyanobacteria.

5 0
3 years ago
Many biotic factors affect individuals in a population. An example of an organism being directly affected by a biotic factor is
astra-53 [7]

Answer:

an example of an organism being directly affected by a biotic factor is

a wood pecker makes holes in a trees bark and that allows insects into the tree killing it the biotic factors are the wood pecker and the insects the affected organism is the tree

Explanation:

7 0
3 years ago
which one of the statements describes an event that takes place during gene regulation at the level of the chromosome?
NISA [10]
Chromatin is remodeled and nucleosomes are repositioned, thereby making specific regions of the DNA available for transcription
8 0
3 years ago
Which statements accurately describe the role of water on Earth? Check all that apply.
gizmo_the_mogwai [7]

Answer:

1,3,5

Explanation:

took test on edg and i got it wrong with answers provided by other people

6 0
3 years ago
Read 2 more answers
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
4 years ago
Other questions:
  • A new nurse observes a priest visiting the clients every saturday afternoon and praying with them. this activity supports which
    14·2 answers
  • Decreasing the saturation of the fatty acid chains on a particular type of phospholipid would result in the formation of _____.
    6·2 answers
  • Question 14
    10·1 answer
  • Is dna copied before meiosis 2
    12·1 answer
  • Which of these is a possible risk associated with stem cell therapy? A) The host’s body could reject the transplanted stem cells
    14·2 answers
  • The cytoplasmic extensions that, together with the cell body, provide the main receptive surfaces for neurons are the
    5·1 answer
  • You are looking through a microscope at a slide of animal tissue and see a single layer of flat, closely packed cells that cover
    11·1 answer
  • This is not a question. This is the answer to PLATO students. <br> Be careful with this question.
    10·1 answer
  • How does the operator region of DNA work to regulate gene expression?
    6·1 answer
  • Evaluate the image below and discuss the information portrayed in Graph A, B and C
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!