1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
2 years ago
6

Widow`s peak is a V-shaped hairline as seen in the picture below. It is a dominant trait. If a male who

Biology
1 answer:
Kitty [74]2 years ago
8 0

Answer:

C. 50%

Explanation:

other ans is a link to virus

don't open it

You might be interested in
Alexander is currently walking to class. This is an example of... Behavior Cognition​
Aleks04 [339]

Answer:

Something

Explanation: It is something

7 0
3 years ago
Are mutations good or bad
Galina-37 [17]

Answer: Mutations can be good or bad.  

Explanation:

4 0
3 years ago
Read 2 more answers
The greater the concentration of sulfur and nitrogen oxides, the higher the pH of precipitation. True False
OLEGan [10]

False

Nitrogen and sulfur dioxide are acidic oxides in nature. The burning of fossil fuels and other sources are responsible for addition of these oxides in the atmosphere of earth. These oxides mixed with water vapor causes acid rain. Being acidic in nature they will have low pH value. Therefore, greater the concentration of sulfur and nitrogen oxides, will lower the pH value of precipitation.

hope this helps:)sorry if it doesnt

6 0
3 years ago
Read 2 more answers
What are some diseases that can be passed down as genetic traits? list 5 or more/
Oxana [17]
The diseases which can be passes down as genetic traits are known as "Inheritable disease" some examples are:

1) Haemophilia
2) Phenylketonuria
3) Down's Syndrome
4) Turner's Syndrome
5) Klinefelter's Syndrome

Hope this helps!
6 0
3 years ago
Read 2 more answers
Which feature of Earth is part of the geosphere?
notka56 [123]

Answer:

Rocks

Explanation:

Geo means “earth.” The Earth’s geosphere (sometimes called the lithosphere) is the part of the Earth that includes all the rocks, minerals and landforms of the surface and interior that make up the Earth. It starts at the ground and extends all the way down to Earth’s core.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Why are nutrition molecules important
    8·1 answer
  • What are the applications of human nervous cells?
    5·1 answer
  • Lipids are important to living things for all of the following reasons, EXCEPT that they are
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which food would be helpful in increasing fiber and regularly clearing the digestive tract?
    15·1 answer
  • The mother of a child has a cleft chin while the father of a child has a smooth chin. The child also has a cleft chin.
    14·1 answer
  • What does DNA stand for
    15·2 answers
  • Why does ice float on liquid water?
    9·1 answer
  • I don’t understand this can someone help me
    11·2 answers
  • What was the dependent variable
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!