1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleks [24]
3 years ago
15

"clumping" or "clouding" in the mixture of the blood and the blood serum is caused by

Biology
1 answer:
luda_lava [24]3 years ago
5 0
I think clumping is caused by the mixture of antigen and the corresponding antibody. Agglutination( clumping) is the process that occurs when an antigen is mixed with its corresponding antibody. This is commonly used in blood grouping. An example is the clumping of red blood cells in the presence of an antibody or complement. In blood transfusion Clumping indicates that the blood has reacted with a certain antibody and is therefore not compatible with blood containing that kind of antibody.
You might be interested in
Which statement accurately describes how organisms make use of the process?
soldi70 [24.7K]

Answer:

The correct answer is plants use photosynthesis to make their own food.

Explanation:

photosynthesis is one of the most important physiological process that occur in plants.

  photosynthesis use the light energy from sun and then convert the light energy to chemical energy.

   The chemical energy is then used used to make glucose various by various enzymatic process.

3 0
3 years ago
​a region of dna that contains instructions for the amino acid sequence of a particular protein is called a(n) ____.
Kisachek [45]

These instructions that produces a specific protein is called the Gene. A gene is a region of DNA that encrypts purpose. A chromosome comprises of a long strand of DNA that involves many genes. A human chromosome can contain up to 500 million base pairs of DNA that has thousands of <span>genes.</span>

8 0
3 years ago
Which explanation is most likely the reason for the evolution of a larger brain in humans?
Alinara [238K]

Answer:

The correct statement is A larger brain allows humans to solve complex problems.

Explanation:

From the ancient time, the human brain has size increased three times. The most probable reason for the evolution of brains is that larger brain allows humans to handle complex problems more easily.

complex and large brains help humans to understand and store a different type of knowledge and information and aids in interacting with each other.  

The current time human has a larger and complex brain in any living primates.

Thus, the correct statement is A larger brain allows humans to solve complex problems.

6 0
3 years ago
Which statement describes the relationship between a gene and an allele?
nadya68 [22]

Answer:

alleles are different versions of a gene

3 0
3 years ago
Read 2 more answers
MATCHING QUESTIONS! WILL AWARD BRAINLIEST!!!!!!
Oliga [24]
1.b
2. a
3.c
4. d
5. e
6. j
7. h
8. i
9. f
10 g

3 0
3 years ago
Other questions:
  • An example of a parallel choices in a key is
    11·2 answers
  • Help me on problem 13 and 14
    15·1 answer
  • Steroids are a major class of____.
    11·1 answer
  • Exobiologists have discovered under the surface of Mars an alien species of single-celled organisms, which undergo sexual reprod
    14·1 answer
  • Which part of an amino acid is always acidic?
    15·2 answers
  • Where would you expect to find humans with the darkest skin color in the Northern Hemisphere (from 10°N to 60°N)?
    5·1 answer
  • 1 poi A student draws a diagram of a plant cell. The diagram is 40mm in width. The plant cell is 0.02mm in width. What is the ma
    14·1 answer
  • Please help 20 points and brainliest.
    15·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • The anther contains (a sepals (b ovules (c caroled. Pollen grain
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!