1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notka56 [123]
3 years ago
15

1. What organisms undergo cellular respiration?

Biology
1 answer:
emmasim [6.3K]3 years ago
3 0
1. Oxygen is required for cellular respiration and is used to break down nutrients, like sugar, to generate ATP (energy) and carbon dioxide and water (waste). Organisms from all kingdoms of life, including bacteria, archaea, plants, protists, animals, and fungi, can use cellular respiration.
2. Mitochondria are often called the “powerhouses” or “energy factories” of a cell because they are responsible for making adenosine triphosphate (ATP), the cell's main energy-carrying molecule.
3. Some cells have more mitochondria than others because they need to process more glucose and produce more ATP.
4. The inner membrane folds over many times and creates layered structures called cristae.
5. In physics, a fluid is a substance that continually deforms (flows) under an applied shear stress, or external force. Fluids are a phase of matter and include liquids, gases and plasmas.
6. Cellular respiration is the process through which cells convert sugars into energy. To create ATP and other forms of energy to power cellular reactions, cells require fuel and an electron acceptor which drives the chemical process of turning energy into a useable form.
Hope I helped you!
You might be interested in
Water is boiled to make steam to turn a generator to send power to a house. The energy conversions involved include ____________
Marina CMI [18]
Mechanical is one of them
6 0
3 years ago
A malaria outbreak causing a Lily's frequencies to change is an example of
Dima020 [189]

Answer:

A malaria outbreak causing allele frequencies to change is an example of <u><em>natural selection.</em></u>

Explanation:

Natural selection is a type of selection in which those organisms are favoured to live and reproduce which are better adapted to live in an environment. Due to natural selection, the allele frequencies of a population will tend to change with the passage of time.

When the outbreak of malaria occurs, those organisms which do not catch malaria are able to survive and pass on their characteristics to their offsprings. the other organisms die and do not reproduce. This will cause changes in the allele frequencies.

6 0
4 years ago
Based on the chart below, if a patient can receive only blood types O- O+ B-, and B+ which blood type does she have
coldgirl [10]
The answer is A) a patient that can receive o- o+ b- and b+ is b+
7 0
4 years ago
Describe two specialized cells in the respiratory system that enable the lungs to function?
Nadya [2.5K]

Answer:

Respiratory epithelial cells line the respiratory tract from trachea to bronchi into bronchioles and alveolar sacs. ... The goblet cells produce and secrete mucous to trap pathogens and debris within the airway tract. Basal cells are progenitor cells that differentiate into cells types found within the epithelium.

5 0
3 years ago
Air pollution:
Aleksandr-060686 [28]

Answer:

Since the early 1900s, many glaciers around the world have been rapidly melting. Human activities are at the root of this phenomenon. Specifically, since the industrial revolution, carbon dioxide and other greenhouse gas emissions have raised temperatures, even higher in the poles, and as a result, glaciers are rapidly melting, calving off into the sea and retreating on land.

Explanation:

5 0
4 years ago
Other questions:
  • Which of the following is true?
    13·2 answers
  • What process is affected by changing environment over time
    10·1 answer
  • Five major earthquakes that hit the philippines
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Sodium and potassium ions move in and out of the axon when the membrane is ______
    9·1 answer
  • Select the correct answer from each drop-down menu.
    7·1 answer
  • How could it be treated?
    13·2 answers
  • Is RNA is the genetic material that makes up genes?
    13·2 answers
  • Save Cite Cited by 4 Related articles All 4 versions [PDF] physiology.org Full View Bistratified starburst amacrine cells in Sox
    14·1 answer
  • cancerous growths are clonal in origin because cancer cells . multiple choice question. can invade healthy tissues originate fro
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!