1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spayn [35]
3 years ago
7

Similar structures shared by common species are called:

Biology
1 answer:
nikklg [1K]3 years ago
7 0

Answer:

I think it’s homologous

Explanation:

You might be interested in
Name three ways that spiders use silk
deff fn [24]
Trap the flys
How they move around
Basically their house
6 0
3 years ago
Read 2 more answers
How does survival of the fittest help keep the ecosystem balanced
xz_007 [3.2K]

The former means those most fit, those with the best set of skills and features for the given environment, will live to pass on the said features in the offspring (with ants, for example, being incredibly fit and adaptable creatures). The latter suggests there is an objective way to measure the "meaningfulness" of each species and having only those most meaningful survive. But this differs from species to species - for a house cat, the great white shark is utterly meaningless.

 Also, the meaningful animal has no actual advantage over another to help him survive, whereas fittness is exactly that - it is the ability to survive, ability to pass on your genes.

 While I understand it may seem so in the case of domestic animals that the most meaningful to the human are those allowed to reproduce, it is actually the same law: those most adapted for human purpose (which, of course, in the given case means the most meaningful) ARE the fittest here in the human-controlled environment.

3 0
3 years ago
At which stage of mitosis are chromosomes usually photographed in the preparation of a karyotype?
____ [38]
Hi cupcake :wink: i'm jk

the answer is b.) metaphase 
6 0
3 years ago
One of the finest available sequences of fossils shows how horses have changed slowly and by subtle steps from small, shrub-brow
ivanzaharov [21]
<span>This fact pattern best fits the idea of the Gradualism Model. This particular model focuses on how species slowly grow and change through evolution over time. Essentially, the model is that species will very slowly change into another type of species as time passes.</span>
8 0
3 years ago
Multiple Choice Question
VLD [36.1K]

Answer:

B. Smaller and more mobile gametes

Explanation:

5 0
3 years ago
Other questions:
  • How could these objects be classified: steak knife, screw, and saw blade? A. Objects made of metal B. Objects used for cutting C
    9·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • An online article that your professor asked you to critique states that African Americans cannot contract malaria, even if they
    14·1 answer
  • Does a tree have a chloroplast and a cell membrane
    6·2 answers
  • How does the endomembranes system work together with ribosomes
    8·2 answers
  • Mutualism is a type of interaction between two species in which
    6·1 answer
  • Some organisms have only Cell
    15·2 answers
  • Mature red blood cells expel their nuclei so that they have more surface area to transport oxygen and
    13·1 answer
  • Identify the object with greatest inertia.
    9·1 answer
  • NEED HELP ASAP
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!