1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spayn [35]
2 years ago
7

Similar structures shared by common species are called:

Biology
1 answer:
nikklg [1K]2 years ago
7 0

Answer:

I think it’s homologous

Explanation:

You might be interested in
Plss help me with this carbon cycle!!!!
Olegator [25]

Answer:

Plants photosynthesize, so they need, thus absorbs carbon dioxide. Marine plants also need carbon dioxide for photosynthesis so they absorb. Dead plant and animal matter decay to release carbon dioxide as a result.

A carbon footprint refers to the greenhouse gas emissions caused both directly, and indirectly, by an individual, a product, an organization, or an event.

4 0
3 years ago
When individuals experience fear and pleasure, what part of the brain has been stimulated?
In-s [12.5K]

Answer:

d. limbic system

Explanation:

The limbic system is concerned with the major role to handle  fear, pleasure, emotion, and hormonal production. The limbic system are associated with the task of regulating the production of internal secretions that are transported around the body by the bloodstream in regards to emotional signals, they also re-enforce behavior associated with fear and pleasure.

7 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Sweating and panting are examples of which characteristics of life?
Keith_Richards [23]
Well it would be an example of homeostasis. As it's trying to control and reestablish your body back to normal. <span />
3 0
3 years ago
Complete the analogy below. Rainfall is to precipitation as groundwater is to _____.
romanna [79]
The correct answer is (b.) infiltration. Rainfall is to precipitation as groundwater is to infiltration. Precipitation is the release of the water from the cloud (evaporated water) in the form of rain and snow. Infiltration is a process in which the water from the ground enters the soil.
5 0
2 years ago
Read 2 more answers
Other questions:
  • Jill stepped on a tack. Which part of the central nervous system caused her foot to move off the tack quickly in a reflex respon
    12·1 answer
  • The primary manner in which cells manage their energy resources in order to do work is called energy coupling. which of the foll
    13·1 answer
  • What functions do capillaries perform in the body?
    9·1 answer
  • What most directly enables salmon to swim in a river
    13·1 answer
  • How dose matter move through the biosphere
    8·1 answer
  • The heart rate increases during exercise. This increase in heart rate increases blood flow to the muscles. Explain, as fully as
    5·1 answer
  • (GIVING BRAINILEST) Which characteristic do stable ecosystems tend to have s
    14·2 answers
  • Which of the following statements about fluid pressure is correct?
    10·2 answers
  • Name things which help man, plant and<br> animal
    10·2 answers
  • What THREE things did Robert Boyle confirm about air?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!