There are several costs associated with using wind turbines to generate electricity.
<u>Explanation:</u>
Using wind turbines to generate electricity comes with the cost of installation of the turbines. A suitable site for installation has to be selected and windmills of the required height are installed. Cost of maintenance is another cost associated with the usage of wind turbines.
The windmills are subjected to several environmental factors like rainfall, sunlight etc. These can cause damage to the windmills. Thus a regular maintenance of the turbines is essential.
Cost of procuring appropriate land for installation of wind turbines is another associated cost. Locations apt for harnessing wind energy are limited. Moreover the windmills have to be set up across a large area to produce energy in a decent scale.
I believe your answer would be B forgive me if im wrong
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell, and that membrane has several different functions. One is to transport nutrients into the cell and also to transport toxic substances out of the cell.
Explanation:
<span>B. A secondary consumer that obtains its energy from the consumption of animals.
The red-tailed hawk is a secondary consumer because it feeds itself on primary consumers (those that eat plants, herbivores). Secondary consumers, by definition, </span><span>obtain their energy from eating other animals. Secondary consumers are also usually the ones that stand on the second and above rows of a food chain, being the plants at the bottom and the primary consumers just above the plants.</span>
