AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
S strain
Explanation:
The Avery experiment demonstrated DNA is the genetic material. It expanded upon the findings made by Griffith.
They used Pneumococcus; Smooth strain which was virulent and the Rough which was not.
Cultures of heat killed smooth strain were prepared after which it was treated with DNases ,RNases and Proteinases to remove DNA, RNA, and proteins respectively. It will then be introduced to living Rough strain.
When treated with RNases only the RNA will be destroyed and transformation will take place leading to colonies of S stains being formed.
Only when treated with DNase did the colonies S strain fail to be formed.
Accumulation of substances such as pesticides or other chemicals in an organism