1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maslowich
3 years ago
8

Please help with this

Biology
1 answer:
creativ13 [48]3 years ago
4 0

Answer:D

Explanation:

You might be interested in
What are the similarities that all the organisms classified under the family Hominidae share?
Debora [2.8K]

Answer:

Among these adaptations are: streamlined bodies for efficient movement through water; forelimbs modified into flippers to aid in steering; hind limbs internalized remnants reducing drag; tail positioned horizontally to achieve a powerful up and down propulsion; hair replaced with under-skin blubber to provide warmth ...

Explanation:

5 0
3 years ago
type ii restriction enzymes, such as ecori, that make staggered cuts within its recognition sequence, are considered more effect
postnew [5]

Type II restriction enzymes, such as Ecor I, that make staggered cuts within its recognition sequence, are considered more effective in biotechnology because they result in cohesive or sticky ends.

<h3>What is Ecor I and why are sticky ends important?</h3>

Ecor I is a kind of restriction enzyme which is obtained from Escherichia coli. The palindromic sequence recognized by this enzyme is 5' - GAATTC - 3'. It makes the following cuts between G and A on both the strands of the DNA to form sticky ends:

5' - G↓AATTC - 3'

3' - CTTAA↑G - 5'

Sticky ends are a fragment of DNA which is produced through a staggered cut, by the use of restriction enzyme. In this the terminal portion stretches with unpaired nucleotides. These kind of ends are easy to ligate when rDNA needs to be formed.

To know more about restriction enzymes, visit:

brainly.com/question/14953274

#SPJ4

5 0
2 years ago
1. How are environmental science and ecology connected?
ludmilkaskok [199]

Answer:

Ecology is the scientific analysis and study of interactions among organisms and their environment. ... Environmental science focuses on the interactions between the physical, chemical, and biological components of the environment, including their effects on all types of organisms.

Explanation:

7 0
4 years ago
Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differen
Alla [95]

Answer:

Option B, It allows different kinds of organisms to be easily identified based on their characteristics

Explanation:

Options for the question are

  • It provides a detailed evolutionary history of all the known organisms on Earth
  • It allows different kinds of organisms to be easily identified based on their characteristics
  • It allows scientists to group organisms based on their personal preference
  • It prevents people who are not scientists from studying and identifying organisms.
  • It allows scientists to to group organisms based on their personal preference
  • It prevents people who are not scientists from studying and identifying organisms ​

Solution

A standardized taxonomic system provides a common basis for the entire scientist community to identify and classify organism on common grounds and hence leading to a standardized organism classification across the globe.  

This also groups organisms into different kingdoms, taxas and classes with defined hierarchy and description of shared traits and characteristics. It also provides scope for inclusion of newly discovered species thereby making the standardized taxonomic system flexible  

Hence, option B is correct

5 0
3 years ago
(Identify) the major types of water pollutants. Suggest ways to reduce the
irakobra [83]

Answer:

Refer below.

Explanation:

Pathogens:We can lessen sewage wastewater by utilizing elective techniques for treatment like drying to create pellets utilized as characteristic.

Organic Matter:We can decrease natural waste by actualizing strategies, for example, treating the soil which can support great microbes and supplement development for horticultural use.

Organic chemicals: We can diminish the utilization of hurtful pesticides and manures and use options, for example, plants to repulse creepy crawlies, for example planting marigolds and basil with vegetables, since they are characteristic repellants. We can utilize dried waste from sewage plants as a more secure manure, which assists with decreasing pathogen contamination at the same time.

Heavy metals:We can line landfills, decrease reject that goes there by utilizing just recyclable materials, and utilize elective, greener cleaning specialists at home, for example, vinegar and lemon.

Physical agents: We can all the more intensely control mechanical and power plants. They ought to be disallowed from releasing warmed wastewater from their plants. Cooling tanks could be utilized to let the temperature of the water normally lessen, and an arrangement of filtration through penetrable and non porous stone, sand, and rock could be utilized to control the stream when the water is in the long run discharged. The cooled water could be sent to be utilized underway of elective oil, similar to that got from green growth, or utilized for arranging which speaks to 1/3 of water utilization in the normal American family unit. Also, elective uses for the high temp water could be discovered, such as utilizing to warm the structure and it's pipes framework through an arrangement of radiators.

8 0
3 years ago
Other questions:
  • Which layer of the earth shell of an egg
    15·1 answer
  • Illnesses that pass from one organism to another are called _____ diseases.
    15·1 answer
  • Compared with all other forms of energy wind power is most similar to title wave power because
    13·1 answer
  • Which best explains how green plants use the sun's energy? A. Special structures in the plant absorb photons. B. Oxygen is heate
    7·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • The introduction of plastics in to the marine environment has also contributed to what other damages to planetary boundaries. Ma
    11·1 answer
  • What are two types of symbiosis?
    12·1 answer
  • "there is no possible way for a whale to be related to an animal that lived on land." Do you agree or disagree
    7·1 answer
  • What would the chromosome to the right be called?
    6·1 answer
  • 1. When mRNA moves out of the nucleus into the cytoplasm it attachs to another RNA
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!