1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
15

5. By about how much did average global temperatures increase from 1880 to 2020?*

Biology
1 answer:
expeople1 [14]3 years ago
4 0
2 degrees Fahrenheit and ~ 1 degree Celsius
You might be interested in
The division of the skeletal system that contains bones along the central line of the body is called what
larisa86 [58]
The skeletal system of a human body gives form, shape, and structure of the body. These includes all the bones and all the joints with each bone being a complex organ itself. 

The skeletal system has two divisions: (1) axial and (2) appendicular. All the vertical 80 axial bones comprised the vertical axis of the body while the 128 including free appendages consist the second division.

The answer to the question above based on the description given is AXIAL. 
3 0
3 years ago
Does mitosis or meiosis involve changes within the nucleus
Leona [35]

<u>Answer:</u>

  • Yes, mitosis or meiosis involve changes with in the nucleus.
  • The process of 'nuclear division in eukaryotic cells' happens when two identical daughter cells are produced by the parent cell division.
  • The cell division reduce the half number of chromosomes on parent cell and four gamete cells are produced.

<u>Explanation:</u>

  • The function of mitosis is to repair, grow and asexual reproduction.
  • The meiosis process claim to produce sperm and egg cells for sexual reproduction.
  • Mitosis produces '2n two diploid cells' that is identical to each other and original parent cell.
  • Meiosis produce n four haploid gametes that are 'genetically unique' to each other.
8 0
3 years ago
What is meant by the following statement? The cell membrane is semipermeable. A. The membrane allows all polar molecules into th
Gennadij [26K]

I believe the correct answer would be B.  Semipermeable means that it allows certain substances to pass through, and certain other ones to not pass through.  So given all of your options, I would say that B makes the most sense.  Hope this helped!

-TTL

7 0
3 years ago
Please help ASAP, Im pretty sure I know the answer, but I'd like a second opinion.​
FinnZ [79.3K]

Answer:

c

Explanation:

7 0
3 years ago
Read 2 more answers
A cell of an organism has four chromosomes. it undergoes a process at the end of which two daughter cells are produced. Each dau
nalin [4]
Based on the Scenario, the process is described as Mitosis

During this process  , chromosomes in a cell nucleus will be separated into two identical set of chromosomes (which make it four) and will end up in their own nucleus 

hope this helps
8 0
3 years ago
Read 2 more answers
Other questions:
  • A plant TT for tall height is crossed with a plant tt for short height. The offspring have the genotype Tt. What is the phenotyp
    10·2 answers
  • Wich bread molds the fastest rye or white bread?
    8·1 answer
  • The face of the moon is only partially visible during which phase
    11·1 answer
  • In the united states, the most at risk and highest reported rates of infection of gonorrhea are among sexually active ________.
    6·1 answer
  • If many different species live in an ecosystem, this helps the ecosystem to fill its _______.
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • what A hypothesis that two organisms from different species are related to each other is best supported by?
    13·1 answer
  • The tip of the pyramid ends in a cuplike structure called the:
    14·1 answer
  • Piyush is asked to classify samples of bacteria as bacilli, cocci, or spirilla.
    5·1 answer
  • Whales in the order Mysteceti are larger than whales in order Odontoceti. Which of the following best explains this?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!