Answer:
The correct answer is: <em>C. Increased average lifespan to 78 in the US.</em>
Explanation:
Science has impacted human health by increasing the average lifespan to 78 in the US. Over the last couple of decades, the life expectancy of Americans has increased significantly than what it was 200 years ago. This can be attributed to:
1. Vaccinations- Since the invention of vaccinations, diseases such as tuberculosis, cholera and polio which were major causes of death 200 years ago have virtually been eradicated in the US.
2. Abundant and safer foods available- Commercial and large scale farming has made a wide variety of nutritious foods easier to obtain.
3. Improved sanitation- Safer drinking water, sewage treatment and stricter food inspection has significantly reduced the rate of illnesses due to poor hygiene and sanitation.
In these ways, science has impacted human health by increasing the average lifespan to 78 in the US.
Answer:
This question lacks options, the options are:
A. All 270 tall plants were heterozygous
B. All 270 tall plants were homzygous.
C. Only 90 plants were homzygous.
D. All dwarf plants were homzygous.
The answer is D.
Explanation:
This question involves a single gene coding for height in pea plants. The allele for tallness (T) is dominant over that of dwarfness (t). This means that a dwarf plant can only be homzygous recessive (tt) while a tall plant can either be homzygous (TT) or heterozygous (Tt).
According to the question, two tall heterozygous pea plants were crossed i.e. Tt × Tt. Based on this cross, a phenotypic ratio of 3:1 is expected, which is in accordance with the 270 tall plants and 90 dwarf plants (360 total) that was obtained in the cross. Since dwarfism in pea plants is a recessive trait, this means that all the dwarf plants produced in this cross (90) were homzygous (tt).
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
KCl is an ionic compound.
Explanation:
