1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
neonofarm [45]
3 years ago
7

Explain how a sudden large net out-migration can impact an aging country.

Geography
1 answer:
mars1129 [50]3 years ago
5 0
That can cause many loses and wins to the country because if there are more people there’s probably more work going to happen but also it can be bad.
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
Science geography help needed.
Serga [27]
The answer is C, a volcanic eruption
6 0
3 years ago
Read 2 more answers
Which of the following results is NOT a way that trade can benefit all parties involved?
Andru [333]

Answer:

answer is c

aExplanation:

5 0
2 years ago
Can someone please help with these questions
never [62]

Answer:

A. Provided them with much of their food

7 0
3 years ago
Read 2 more answers
Polytheistic religions teach the worship of __________.
Vitek1552 [10]

Answer:

Many gods?

Explanation:

Polytheistic religions have multiple gods that's all I know I hope this helps.

5 0
2 years ago
Other questions:
  • Q: How are two ecozones always different from each other? A: A.They have different climates. B.They have different political sys
    7·2 answers
  • Some of the strongest advances in Southern industry were in ____. A. music B. dairy farming C. printing D. textiles
    15·2 answers
  • What happens during the entire fusion process in the Sun? Two hydrogen nuclei come together to produce one helium nucleus and tw
    6·2 answers
  • Conflicts over territory and government are a common consequence of countries unifying or splitting apart. If each state in the
    5·1 answer
  • Earth’s biosphere is
    9·2 answers
  • You own a beachfront lot that has been experiencing erosion due to beach starvation. Your neighbor to the north (up-current) has
    14·1 answer
  • how did the people of kibera (Nairobi, Kenya) use the data they collected themselves to improve their quality of life​
    5·2 answers
  • Describe two ways demand for petroleum has been reduced.
    12·1 answer
  • How is it possible that members of a population of animals, like dogs, have variations in their traits, such as ear shape, fur c
    7·1 answer
  • What city is located closest to 35N-105w?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!