I think that the answer is H. However, I am not 100% sure so I would advise you to double check your notes.
=====|>WHAT DO YOU MEAN<|===== :/
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Answer:
The hormone responsible for these changes is progesterone, which is manufactured by the corpus luteum. Under the influence of progesterone, the uterus begins to create a highly vascularized bed for a fertilized egg. If a pregnancy occurs, the corpus luteum produces progesterone until about 10 weeks gestation.
A monosaccharide is the monomer of a carbohydrate. Carbohydrates, such as sugars and starches, store energy. Some monosaccharides are isomers .This means that they have the same chemical formula but a different arrangement of atoms. An example of such a pair of isomers is glucose and fructose.