1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Art [367]
3 years ago
7

Name three different massive stars

Biology
2 answers:
ryzh [129]3 years ago
6 0

Answer:

The sun, T-Tauri, Lambda Bootis,

Explanation:

Roman55 [17]3 years ago
5 0

Answer:

R136c: 230 solar masses.

BAT99-98: 226 solar masses.

R136a2: 195 solar masses.

You might be interested in
Which best describes Darwin's studies that led to the theory of evolution?​
const2013 [10]
Do you have a picture of the question?


If not the Darwinism is a theory of Biloxi all evolution developed by the English naturalist Charles Darwin and others stating that all species of organism arise and develop through the natural selection of small, inherited variations that increase the individual’s ability to compete, survive and reproduce
6 0
4 years ago
Read 2 more answers
When a fish swims from salt water into fresh water, its cells react by:
Sever21 [200]

When a fish swims from salt water into fresh water its cells react by losing water and shrinking.​ The correct option is D.

<h3>What is fresh water?</h3>

Glaciers, lakes, reservoirs, ponds, rivers, streams, wetlands, and even groundwater contain fresh water.

These freshwater habitats cover less than 1% of the world's total surface area but are home to 10% of all known animals and up to 40% of all known fish species.

When a fish swims from salt water into fresh water its cells react by losing water and shrinking due to osmosis.​

Thus, the correct option is D.

For more details regarding fresh water, visit:

brainly.com/question/4381433

#SPJ1

6 0
2 years ago
Read 2 more answers
It is projected that an increase in carbon dioxide levels in the atmosphere will MOST LIKELY lead to
ad-work [718]

Answer:

Option a) higher the average sea levels.

Explanation: Carbondioxide is also known as greenhouse gas. When carbondioxide concentration is higher in the atmosphere, it prevents the reflected sunlight from going into the atmosphere which increases the temperature of the surrounding air. This phenomenon is called global warming. This increase in temperature starts melting of ice which are present on mountains and thus, increases sea level.

4 0
3 years ago
Which of the following is a limitation of a clinical trial?
dusya [7]

Answer:

C. amount of peer review.

Explanation:

3 0
2 years ago
The giant planets are made of "gases," ______, and ______.
Inga [223]

Answer:

I could be wrong but I believe it is,

"rocks," and "dark matter"

3 0
4 years ago
Other questions:
  • Which conditions would be the most favorable for an organism that reproduces asexually?
    12·2 answers
  • In cells, the production of proteins is handled by the ribosomes and endoplasmic reticulum, while the processing and packaging o
    12·2 answers
  • Savannas typically have more trees than grasslands. Please select the best answer from the choices provided T F
    14·2 answers
  • The equation for the chemical reaction shown is not balanced. What number should replace the question mark to balance this equat
    8·1 answer
  • in sickle-cell disease variation is one gene cause red blood cells to bend or sickle this means the sickle cells
    10·1 answer
  • An interaction in which an animal feed on plants is called A) carnivory B) herbivory C) predation D) symbiosis
    8·2 answers
  • Why does a dissolved substance reduce the number of free water molecules in a solution?      <br> ​
    15·1 answer
  • Recombinant DNA ________. is the merging of DNA from unrelated organisms to create new genetic varieties is assembled in the lab
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Mr. Carter draws a box with a particle diagram of a liquid on the whiteboard. Next, he draws another box with a particle diagram
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!