1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masja [62]
3 years ago
13

Inversion of DNA sequences within chromosomes is a common process in evolution. The following gene arrangements in a particular

chromosome are found in four different species: First sequence: STUVWX Second sequence: UVXTSW Third sequence: UVWSTX Fourth sequence: SWVUTX Assuming that the arrangement in the first sequence is the ancestor/reference arrangement, in what evolutionary order did the four species arise, such that the fewest number of inversions occur between each species (place the first sequence as the earliest species in your ordering)2341
Biology
1 answer:
Tju [1.3M]3 years ago
6 0

Answer:

The correct answer is - 1, 4, 3, 2.

Explanation:

It is given that the first sequence represents the earliest or ancestor species therefore, the first sequence would be - STUVWX

After the inversion, the highlighted sequence of the first sequence STUVWX gives rise to the second sequence as:

STUVWX

SWVUTX

Thus the second sequence after Ist inversion would be SWVUTX

2nd inversion, Third sequence:

SWVUTX

UVWSTX

Thus the third sequence after 2nd inversion is UVWSTX

3rd inversion, fourth sequence:

UVWSTX

UVXTSW

Thus, the fourth sequence after 3rd inversion is UVXTSW

You might be interested in
What is the term for a male reproductive cell?
Rufina [12.5K]
c. because only male repoduce sperm
5 0
3 years ago
Mitochondria and chloroplasts have a number of features in common. Which of the following is NOT one of them?
JulijaS [17]

Both are found in all eukaryotic cells.


7 0
3 years ago
The Drongo bird steals food from meerkats by tricking them This is an example of
Ymorist [56]

Answer:

There <u>warning calls</u> of other animals to scare them away from food.

Explanation:

Honest sentry to deceptive thief.

7 0
2 years ago
There are three major groups of mammals, categorized on the basis of their _____. see concept 34.6 ( page 739)
zmey [24]
<span>There are three major groups of mammals, categorized on the basis of their method of reproduction. Monotremes lay eggs to have children instead of having the mother bear them. The second type of mammal is the marsupial, which are non-placental animals who carry their young in their pouches. Eutherians are the third group who are placental mammals.</span>
4 0
3 years ago
Explain why the cane toad was a failure as a biological control method in Australia.
kakasveta [241]
The cane toad was a failure as a biological control method in Australia because:
-The greyback beetle it was supposed to be eating fed at the top of the sugarcane stalks (which were 6-8 meters in height). Cane toads cannot fly or climb and therefore couldnt feed on the beetles.
-The beetles were out during the daytime, and cane toads feed at night.
-The two species are not seasonally compatible (aren't in the same place at the same time of year).
-The toads needed moist conditions to survive, and so moved away from where they were supposed to be.
-The cane toad eats many native species and often out-competes native species for food and breeding sites, leading to the decline of natives.
-Breeding habits made the cane toads a very invasive species.
7 0
3 years ago
Other questions:
  • One of the most fundamental differences in hinduism is the split between viewpoints that are monistic and
    7·1 answer
  • I put all the points i had in this s please help
    12·1 answer
  • How are the results of genetic drift similar to the results of gene flow?
    12·1 answer
  • Starting from the mouth, describe the pathway that takes through the digestive system
    10·1 answer
  • What’s an easy explanation of the steps for the phosphorus cycle?
    12·1 answer
  • Which neural center in the limbic system helps process explicit memories for storage?
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Many coastal communities oppose the proposal to set up tidal plants, even though they recognize that the solution to the current
    12·1 answer
  • PLZZZZ HELP List the six kingdoms.
    12·2 answers
  • Please help asap. i really need to finisht this
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!