1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
13

Taxonomy is ________

Biology
1 answer:
creativ13 [48]3 years ago
3 0

Answer:

the branch of science concerned with classification, especially of organisms; systematics.

Explanation:

You might be interested in
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Newton's laws of motion are not used to describe what happens when an object
Elenna [48]

Answer:

Gets caught on fire

Explanation:

took the test

3 0
3 years ago
Read 2 more answers
1. How Widespread is asexual reproduction in plants as compared to animals?
Alexxandr [17]

Explanation:

How widespread is asexual reproduction in planets an compared to animals which methods of asexual reproduction occur in both animals and plants

5 0
3 years ago
In acculturation, subordinate groups will often incorporate new cultural elements into their own culture, creating a blend of ol
Elenna [48]

Answer:

The question is incomplete and should be:

In acculturation, subordinate groups will often incorporate new cultural elements into their own culture, creating a blend of old and new. A reinterpretation of new cultural elements to fit them with already existing traditions is called:___________

a.innovation.

b.syncretism.

c.assimilation.

d.acculturation.

e.modernization.

THE ANSWER IS B (SYNCRETISM)

Syncretism is a merging of different beliefs, cultures, school of thoughts or philosophies

5 0
3 years ago
Which species is most likely to exhibit clumped dispersion?
Sliva [168]
Search Results
Featured snippet from the web
Clumped dispersion. In a clumped dispersion, individuals are clustered in groups. A clumped dispersion may be seen in plants that drop their seeds straight to the ground—such as oak trees—or animals that live in groups—schools of fish or herds of elephants.
7 0
3 years ago
Other questions:
  • What does entropy measure?
    12·2 answers
  • Protists are prokaryotic. T/F
    7·1 answer
  • Assess the importance or value of having decomposers in the food web
    12·1 answer
  • Does trna bring amino acids to the nucleus or ribosomes
    6·1 answer
  • Which characteristic cannot be inherited
    11·2 answers
  • How does the warming of the ocean affect the water cycle?
    14·2 answers
  • A scientist discovers an important breakthrough in cancer treatment. The scientist thinks the information could save thousands o
    14·1 answer
  • Describe three ways to slow population growth
    15·2 answers
  • 23. Which macromolecule is responsible for the creation of proteins?
    10·1 answer
  • Please help I only have 34 minutes
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!