Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Explanation:
How widespread is asexual reproduction in planets an compared to animals which methods of asexual reproduction occur in both animals and plants
Answer:
The question is incomplete and should be:
In acculturation, subordinate groups will often incorporate new cultural elements into their own culture, creating a blend of old and new. A reinterpretation of new cultural elements to fit them with already existing traditions is called:___________
a.innovation.
b.syncretism.
c.assimilation.
d.acculturation.
e.modernization.
THE ANSWER IS B (SYNCRETISM)
Syncretism is a merging of different beliefs, cultures, school of thoughts or philosophies
Search Results
Featured snippet from the web
Clumped dispersion. In a clumped dispersion, individuals are clustered in groups. A clumped dispersion may be seen in plants that drop their seeds straight to the ground—such as oak trees—or animals that live in groups—schools of fish or herds of elephants.