1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Stella thinks that if people are exposed ultraviolet light then they are more likely get skin cancer. Stella designs an experime

nt wherein sample A consisted of people were exposed to ultraviolet light and sample B was not.
what is the independent variable?
Biology
2 answers:
alekssr [168]3 years ago
5 0
Independent variable: is the UV light exposure

Control group: people not exposed (sample b)

Dependent variable: skin cancer

Experimental group: (sample A)
lisabon 2012 [21]3 years ago
5 0

Answer:

The amount of UV light exposure.

Explanation:

The independent variable is the one variable that an individual must change during an experiment in order to investigate or test the dependent variable. Basically their relationship to the experiment or between themselves can be easily remembered through their names: The independent variable is the one that's controlled by the researcher and therefore does not <em>depend</em> on other variables from the experiment (amount of UV light), the dependent variable <em>depends</em> on the independent variable since its often the result from the latter's variations (cases where people developed skin cancer) and finally, the controlled variable is the one that's kept the same throughout the experiment (Time exposed to sunlight within group A or method through which patients were tested for skin cancer).

You might be interested in
The combination of a chemical reaction through which an organism builds up or breaks down materials as it carries out its life p
wlad13 [49]
Metabolism

Hope this helps!
5 0
3 years ago
Whenever the characteristics and chemical composition of weathered materials have been altered, they have undergone _____?
poizon [28]
The answer to your is Chemical Weathering
5 0
3 years ago
Read 2 more answers
External fertilization in fishes is called ____________.
alexandr402 [8]
Spawning.......................................................
7 0
2 years ago
Water molds are fungus-like and heterotrophic. Why are they classified as chromists rather than protozoans or fungi
Colt1911 [192]

Answer:

The cell wall of oomycetes, however, is not composed of chitin, as in the fungi, but is made up of a mix of cellulosic compounds and glycan. The nuclei within the filaments are diploid, with two sets of genetic information, not haploid as in the fungi.

4 0
2 years ago
Colocar la opción correcta.
Dafna11 [192]

Answer: A y B son correctas

Explanation:

4 0
2 years ago
Other questions:
  • The metaphyses of a 40-year-old's long bones have?
    10·1 answer
  • Please help there’s 3 questions at the bottom left.
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Can photosynthesis happen in the dark?
    14·2 answers
  • Which of the following initially determines which DNA strand is the template strand, and therefore in which direction RNA polyme
    13·2 answers
  • Which of the following processes is directly affected by the cardiovascular system? hair growth muscle strength healing of cuts
    15·2 answers
  • What is difference between nervous and chemical(endocrine) system???
    14·2 answers
  • Is this a scientific model? Please explain why or why not.
    9·2 answers
  • PLS HELP DUE TODAY! IF U ANSWER U GET BRAINLIEST!
    13·1 answer
  • Cystitis is most often caused by Group of answer choices Escherichia coli. Leptospira interrogans. Candida albicans. Neisseria g
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!