1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
15

Which of the following is a consequence of both type 1 and type 2 diabetes?

Biology
1 answer:
uysha [10]3 years ago
6 0
A. Hyperglycemia

The pancreas cannot make enough insulin, which is the hormone that regulates how carbohydrates are broken down. Hyper means over. Glyc is like sugars. It means too much sugar pretty much.
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Three examples of complex hereditary diseases are cardiovascular disease, type 2 diabetes, and .
Alenkinab [10]
The third example will be “cancer”
6 0
3 years ago
A gallon of olive oil sitting on a high shelf is likely to have:
valentinak56 [21]
B. Because it has potential energy and it’s not kinetic energy because that’s what it would have if that container fell.
8 0
2 years ago
Read 2 more answers
What happens when an ecosystem is in equilibrium???
andrezito [222]
Ecosystems equilibrium is when populations of organisms in the ecosystem are balanced.
5 0
3 years ago
TIME REMAINING
jolli1 [7]

Answer:

a

a process that selects variations to help with survi al and that spreads the variation to more offspring

Explanation:

the weak don't survive the strong thrive

3 0
3 years ago
Other questions:
  • Your teacher just called on you for the answer to one of today's word puzzles and you got it right! She throws a starburst at
    5·1 answer
  • A flower's sepal is part of the corolla.<br> True/False?
    5·1 answer
  • . Consider the following scenarios. State whether the mutation is likely to be passed on to the offspring of the organism. Expla
    10·1 answer
  • precipitation _____. occurs equally all over the globe is the change in state from a gas to a liquid happens when ice changes in
    11·2 answers
  • While mutations are rare, they may result in a hereditary disease. They occur because of _____.
    5·1 answer
  • having hair on the back of the hand is dominant (H) and not having the hair is recessive (h) a mother has Hh and a father has hh
    15·1 answer
  • If the codon is GUC, what is the anticodon
    9·2 answers
  • Describe why trasnsitioning to a hydrogen economy has advantages.<br> PLEASE HELLPPPPP
    15·2 answers
  • State the processes of nitrogen,carbon and water cycle​
    11·1 answer
  • What is the current measured ppm of co2 in our atmosphere?.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!