1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
7

A) How long will it take for 40.0 grams of Radium-226 (Ra-226) to decay to leave a total of 2.5 grams of Ra-226? Ra-226 has a ha

lf-life of 1600 years.
B) If there are 80.0 grams of Neptunium-240 (Np-240), how much Neptunium-240 will remain after 4 hours? The half-life of Neptunium-24 is 1 hour.
Biology
2 answers:
kumpel [21]3 years ago
8 0

Answer:

a) 6400 years

b) 5 grams

Explanation:

a) to get 6400 years, the 40 grams is halved 4 times to get to 2.5g and 4 times 1600 is 6400

b) 80 is halved 4 times and the final result you get is 5 grams

80/2= 40/2= 20/2=10/2=5

each divided by 2 represents 1 hour

sergey [27]3 years ago
4 0

Answer:

[ A ] 6400 years

[ B ] 5 grams

Explanation:

You might be interested in
Write any three problems with the measurement of quantities that the SI unit system has solved.​
ValentinkaMS [17]

Explanation:

1. they are convenient to use 2. it helps the international tade 3. it eases the exchange of material

3 0
3 years ago
Help a person in need will ya? It will be kind of you to help me.
timama [110]

Answer:

Not under microscope:

Brownian motion is the constant but irregular zigzag motion of small colloidal particles such as smoke, soot, dust, or pollen that can be seen quite clearly through a microscope.

Under microscope:

detailed with texture (just go on about how it looks)

also what grade is this? Is this high school orrr

Explanation:

4 0
3 years ago
This can contribute to desert formation:
Tatiana [17]

Answer:

C

Explanation:

Due to the erosion of soils, no trees to protect the ground from drying out.

3 0
3 years ago
Read 2 more answers
Which of the following is not found in the nucleus of an animal cell?
bezimeni [28]
Mitochondrion is found outside of nucleus in animal cell .

So , i think the answer is B.
8 0
2 years ago
A nurse has invited a patient to sit down and have a conversation. the patient takes the first seat. the nurse pulls up another
kirill [66]
Of course! Treat him well!
8 0
3 years ago
Other questions:
  • Which of the following accurately describes a step within transcription?
    6·2 answers
  • Indentify a true statement about duffusion
    6·2 answers
  • Where does cellular respiration take place in the cell?
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What does it mean when a population’s growth becomes steadily less until it stops growing and stays at a steady size?
    7·1 answer
  • What is the grain size of the sedimentary rock "chert"?
    13·1 answer
  • Question 48 (1 point)
    8·1 answer
  • Which event occurs in the large intestine?
    6·1 answer
  • -How do you think andioxidants can help cells perform their functions? -Why do plants have more antioxidants than humans? -Do yo
    8·1 answer
  • What is the ion formation of Li3
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!