1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
3 years ago
9

Low pitched male voices (RR) and a high pitched male voice (rr). Heterozygotes have a baritone voice. This is an example of ____

_____
Biology
1 answer:
Lemur [1.5K]3 years ago
3 0

Answer: incomplete dominance

Explanation:

Incomplete dominance is also referred to as partial dominance or semi dominance. It occurs when the two forms of gene in a trait combine in such a way that one does not have a dominance over the other one. Therefore, there's a blend of both genes in the physical appearance of such organism.

Therefore, a low pitched male voices (RR) and a high pitched male voice (rr). Heterozygotes have a baritone voice is an example of incomplete dominance.

You might be interested in
Which is one of the five characteristics of life?
Thepotemich [5.8K]
One characteristic of life is that living things have different levels of organization -They have both molecular and cellular organization - They must have the ability to organize simple substances into complex ones. - They organize cells at several types of levels, namely: (a) Tissue- a group of cells that perform a common function (b) Organ - A group of tissues that perform a common function. (c) Organ system- a group of organs that perform a common function. (d) Organism- any complete living thing.
5 0
3 years ago
Read 2 more answers
El encargado de materiales de su grupo debe ir a recoger los materiales.
Bas_tet [7]

Answer:

todos deben tener los materiales por si a alguien se le olvida un material

tu se lo prestes

Explanation:

por que es en equipo

3 0
2 years ago
PLEASE help me ahahaha
Korolek [52]
The answer is B mutualism
8 0
3 years ago
Read 2 more answers
Which of the following is not one of the kingdoms of living things
joja [24]
Grass I think Bc it’s not a living thing
3 0
3 years ago
Que es el significado de la palabra axiológica ?
AleksandrR [38]
<span>Axiológico es todo lo que se refiere a un concepto de valor o que constituye una axiología, es decir, los valores predominantes en una determinada sociedad.</span>
6 0
2 years ago
Other questions:
  • "which maternal condition is considered a contraindication"
    7·1 answer
  • In any population there will be variations of certain characteristics. For example, in the giraffe population there is a variati
    5·2 answers
  • A long afternoon of hard work lies ahead. You will need lots of energy so you're get ready to dig into your lunch, seen here. Wh
    15·1 answer
  • Transpiration is one part of the
    13·1 answer
  • The wing of a bird and the wing of a butterfly. Analogous or homologous
    8·1 answer
  • 1<br><br>2 3333333333333333dgnnnnnnnnnxz
    13·1 answer
  • what process in most responsible for the extinction of most species of plants an animals that have lived on earth?
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Clarence made a diagram to compare codominance and incomplete dominance. Which label belongs in the area marked Y? Neither allel
    7·2 answers
  • What advantage over an aquatic organism does a terrestrial organism have with obtaining oxygen.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!