If he tries it with more than one willow tree, different amounts of water, and or soil.
The correct answer is (a.) liver. The liver contains the tubules with sinusoids which is lined with macrophages that leads to the central venous structure. A liver is a vital organ that serves as a gland that plays an important role in animal's and vertebrae's metabolism.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.
Explanation:
Fatty acids are the building blocks of lipids
WHAT ARE LIPIDS?
- Lipids are one of the four major biological molecules in nature (the other three are proteins, carbohydrates and nucleic acids).
- Lipids are organic compounds that are generally characterized by their insolubility in water.
MONOMERS OF LIPIDS:
- Lipids, like every other biological molecule, are polymeric compounds i.e. they are made up of smaller monomeric units. The monomers that make up lipids are called FATTY ACIDS.
Therefore, fatty acids are the building blocks of lipids.
Learn more: brainly.com/question/18846036
